# AUTOGENERATED FILE! PLEASE DON'T EDIT HERE. EDIT THE SOURCE NOTEBOOKS INSTEAD
"""
This is for functions that are actually biology-related
"""
from k1lib.cli.init import BaseCli
import k1lib; import k1lib.cli as cli
import os; from functools import partial
from typing import Iterator, Union
__all__ = ["go", "quality", "longFa", "idx",
"transcribe", "complement", "translate", "medAa", "longAa"]
settings = k1lib.Settings()
k1lib.settings.cli.add("bio", settings, "from k1lib.cli.bio module");
def _patchDir(term, s, p): # _patchDir
if p != None: p = os.path.abspath(os.path.expanduser(p)) # _patchDir
s.__dict__[term] = p # _patchDir
settings.add("blast", None, "location of BLAST database", partial(_patchDir, "blast")) # _patchDir
settings.add("go", None, "location of gene ontology file (.obo)", partial(_patchDir, "go")) # _patchDir
settings.add("so", None, "location of sequence ontology file", partial(_patchDir, "so")); # _patchDir
settings.add("lookupImgs", True, "sort of niche. Whether to auto looks up extra gene ontology relationship images") # _patchDir
[docs]def go(term:int): # go
"""Looks up a GO term""" # go
if settings.go is None and not os.path.exists("go.obo"): # go
answer = input("""No gene ontology obo file specified! You can:
- Specify the file using `settings.cli.bio.go = '/some/folder/go.obo'`
- Download this automatically to file `go.obo`
You want to download this automatically? (y/n) """) # go
if answer.lower().startswith("y"): # go
url = "http://current.geneontology.org/ontology/go.obo" # go
print(f"Downloading from {url}... ", end="") # go
cli.wget(url); print("Finished!") # go
else: return print("Aborted") # go
file = settings.go or "go.obo"; term = f"{term}".rjust(7, "0") # go
cli.cat(file) | cli.grep(f"id: GO:{term}", 0, 10) > cli.stdout() # go
print(f"https://www.ebi.ac.uk/QuickGO/GTerm?id=GO:{term}") # go
if settings.lookupImgs: # go
class Repr: # go
def _repr_html_(self): # go
return f"""<img src="http://amigo.geneontology.org/visualize?mode=amigo&term_data_type=string&format=png&inline=false&term_data=GO%3A{term}" />""" # go
return Repr() # go
settings.add("phred", """!"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJ""", "Phred quality score") # go
class toIdx(BaseCli): # toIdx
def __init__(self, chars:str): self.chars = {v:k for k, v in enumerate(chars)} # toIdx
def __ror__(self, it): # toIdx
chars = self.chars # toIdx
for e in it: yield chars[e] # toIdx
[docs]def quality(log=True): # quality
"""Get numeric quality of sequence.
Example::
# returns [2, 2, 5, 30]
"##&?" | quality() | deref()
:param log: whether to use log scale (0 -> 40), or linear scale (1 -> 0.0001)""" # quality
if log: return toIdx(settings.phred) # quality
else: return toIdx(settings.phred) | cli.apply(lambda x: 10**(-x/10)) # quality
[docs]def longFa(): # longFa
"""Takes in a fasta file and put each sequence on 1 line.
File "gene.fa"::
>AF086833.2 Ebola virus - Mayinga, Zaire, 1976, complete genome
CGGACACACAAAAAGAAAGAAGAATTTTTAGGATC
TTTTGTGTGCGAATAACTATGAGGAAGATTAATAA
>something other gene
CGGACACACAAAAAGAAAGAAGA
TTTTGTGTGCGAATAACTATGAG
Code::
cat("gene.fa") | bio.longFa() | cli.headOut()
Prints out::
>AF086833.2 Ebola virus - Mayinga, Zaire, 1976, complete genome
CGGACACACAAAAAGAAAGAAGAATTTTTAGGATCTTTTGTGTGCGAATAACTATGAGGAAGATTAATAA
>something other gene
CGGACACACAAAAAGAAAGAAGATTTTGTGTGCGAATAACTATGAG""" # longFa
return cli.grep("^>", sep=True).till() | (cli.item() & (~cli.head(1) | cli.join(""))).all() | cli.joinStreams() # longFa
def _fileWithoutExt(f): return ".".join(f.split(".")[:-1]) # _fileWithoutExt
[docs]class idx(BaseCli): # idx
"""Indexes files with various formats.""" # idx
[docs] @staticmethod # idx
def blast(fileName:str=None, dbtype:str=None): # idx
"""Uses ``makeblastdb`` to create a blast database from a fasta file.
Example::
"file.fa" | bio.idx.blast()
bio.idx.blast("file.fa")""" # idx
f = cli.applyS(lambda fileName: None | cli.cmd(f"makeblastdb -dbtype {dbtype or 'nucl'} -in {fileName} -out {_fileWithoutExt(fileName)}")) # idx
return f if fileName is None else f(fileName) # idx
[docs] @staticmethod # idx
def bwa(fileName:str=None): # idx
"""Uses ``bwa`` to index a fasta file.
Example::
"file.fa" | bio.idx.bwa()
bio.idx.bwa("file.bwa")""" # idx
f = cli.applyS(lambda fileName: None | cli.cmd(f"bwa index {fileName}")) # idx
return f if fileName is None else f(fileName) # idx
[docs] @staticmethod # idx
def bam(fileName:str=None): # idx
"""Uses ``samtools`` to index a bam file.
Example::
"file.bam" | bio.idx.bam()
bio.idx.bam("file.bam")""" # idx
f = cli.applyS(lambda fileName: None | cli.cmd(f"samtools index {fileName}")) # idx
return f if fileName is None else f(fileName) # idx
[docs]class transcribe(BaseCli): # transcribe
"""Transcribes (DNA -> RNA) incoming rows.
Example::
# returns "AUCG"
"ATCG" | transcribe()
# returns ["AUCG"]
["ATCG"] | transcribe() | deref()""" # transcribe
[docs] def __ror__(self, it:Union[Iterator[str], str]): # transcribe
if isinstance(it, str): return [it] | self | cli.item() # transcribe
return (line.upper().replace("T", "U") for line in it) # transcribe
[docs]class complement(BaseCli): # complement
"""Get the reverse complement of DNA.
Example::
# returns "TAGC"
"ATCG" | bio.complement()
# returns ["TAGC"]
["ATCG"] | bio.complement() | deref()""" # complement
[docs] def __ror__(self, it:Union[Iterator[str], str]): # complement
if isinstance(it, str): return [it] | self | cli.item() # complement
return (line.upper().replace("A", "0").replace("T", "A").replace("0", "T").upper().replace("C", "0").replace("G", "C").replace("0", "G") for line in it) # complement
ntAa = {"UUU": "F", "UUC": "F", "UUA": "L", "UUG": "L", # complement
"UCU": "S", "UCC": "S", "UCA": "S", "UCG": "S", # complement
"UAU": "Y", "UAC": "Y", "UAA": "*", "UAG": "*", # complement
"UGU": "C", "UGC": "C", "UGA": "*", "UGG": "W", # complement
# complement
"CUU": "L", "CUC": "L", "CUA": "L", "CUG": "L", # complement
"CCU": "P", "CCC": "P", "CCA": "P", "CCG": "P", # complement
"CAU": "H", "CAC": "H", "CAA": "Q", "CAG": "Q", # complement
"CGU": "R", "CGC": "R", "CGA": "R", "CGG": "R", # complement
# complement
"AUU": "I", "AUC": "I", "AUA": "I", "AUG": "M", # complement
"ACU": "T", "ACC": "T", "ACA": "T", "ACG": "T", # complement
"AAU": "N", "AAC": "N", "AAA": "K", "AAG": "K", # complement
"AGU": "S", "AGC": "S", "AGA": "R", "AGG": "R", # complement
# complement
"GUU": "V", "GUC": "V", "GUA": "V", "GUG": "V", # complement
"GCU": "A", "GCC": "A", "GCA": "A", "GCG": "A", # complement
"GAU": "D", "GAC": "D", "GAA": "E", "GAG": "E", # complement
"GGU": "G", "GGC": "G", "GGA": "G", "GGG": "G"} # complement
_shortAa = {v:v for v in ntAa.values()} # complement
_medAa = { # complement
"F": "Phe", "L": "Leu", "I": "Ile", "M": "Met", "V": "Val", # complement
"S": "Ser", "P": "Pro", "T": "Thr", "A": "Ala", "Y": "Tyr", # complement
"*": "Stop", "H": "His", "Q": "Gln", "N": "Asn", "K": "Lys", # complement
"D": "Asp", "E": "Glu", "C": "Cys", "W": "Trp", "R": "Arg", # complement
"G": "Gly", "U": "Sec", "?": "?" # complement
} # complement
_longAa = { # complement
"F": "Phenylalanine", "L": "Leucine", "I": "Isoleucine", "M": "Methionine", "V": "Valine", # complement
"S": "Serine", "P": "Proline", "T": "Threonine", "A": "Alanine", "Y": "Tyrosine", # complement
"*": "Stop", "H": "Histidine", "Q": "Glutamine", "N": "Asparagine", "K": "Lysine", # complement
"D": "AsparticAcid", "E": "GlutamicAcid", "C": "Cysteine", "W": "Tryptophan", "R": "Arginine", # complement
"G": "Glycine", "U": "Selenocysteine", "?": "?" # complement
} # complement
[docs]class translate(BaseCli): # translate
[docs] def __init__(self, length:int=0): # translate
"""Translates incoming rows.
:param length: 0 for short (L), 1 for med (Leu), 2 for long (Leucine)""" # translate
super().__init__(); self.delim = "" if length == 0 else " " # translate
self.dict = [_shortAa, _medAa, _longAa][length] # translate
[docs] def __ror__(self, it:Iterator[str]): # translate
super().__ror__(it) # translate
if isinstance(it, str): it = [it] # translate
it = it | transcribe() # translate
for line in it: # translate
line = line.replace(" ", "") # translate
answer = ""; n = len(line) # translate
for i in range(0, n - n % 3, 3): # translate
codon = line[i:i+3].upper() # translate
answer += (self.dict[ntAa[codon]] if codon in ntAa else "?") + self.delim # translate
yield answer # translate
[docs]class medAa(BaseCli): # medAa
"""Converts short aa sequence to medium one""" # medAa
[docs] def __ror__(self, it:Iterator[str]): # medAa
if isinstance(it, str): it = [it] # medAa
for line in it: # medAa
yield " ".join(_medAa[c] for c in line) # medAa
[docs]class longAa(BaseCli): # longAa
"""Converts short aa sequence to long one""" # longAa
[docs] def __ror__(self, it:Iterator[str]): # longAa
if isinstance(it, str): it = [it] # longAa
for line in it: # longAa
yield " ".join(_longAa[c] for c in line) # longAa