k1lib.cli module

Setup

To install the library, run this in a terminal:

pip install k1lib[all]

If you don’t want to install extra dependencies (not recommended), you can do this instead:

pip install k1lib

To use it in a python file or a notebook, do this:

from k1lib.imports import *

Because there are a lot of functions with common names, you may have custom functions or classes that have the same name, which will override the functions in the library. If you want to use them, you can use cli.sort() instead of sort() for example.

Intro

The main idea of this package is to emulate the terminal (hence “cli”, or “command line interface”), but doing all of that inside Python itself. So this bash statement:

cat file.txt | head -5 > headerFile.txt

Turns into this statement:

cat("file.txt") | head(5) > file("headerFile.txt")

Let’s step back a little bit. In the bash statement, “cat” and “head” are actual programs accessible through the terminal, and “|” will pipe the output of 1 program into another program. cat file.txt will read a file and returns a list of all rows in it, which will then be piped into head -5, which will only return the first 5 lines. Finally, > headerFile.txt will redirect the output to the “headerFile.txt” file. See this video for more: https://www.youtube.com/watch?v=bKzonnwoR2I

On the Python side, “cat”, “head” and “file” are Python classes extended from BaseCli. cat("file.txt") will read the file line by line, and return a list of all of them. head(5) will take in that list and return a list with only the first 5 lines. Finally, > file("headerFile.txt") will take that in and writes it to a file.

You can even integrate with existing shell commands:

ls("~") | cmd("grep *.so")

Here, “ls” will list out files inside the home directory, then pipes it into regular grep on linux, which is then piped back into Python as a list of strings. So it’s equivalent to this bash statement:

ls | grep *.so

Let’s see a really basic example:

# just a normal function
f = lambda x: x**2
# returns 9, no surprises here
f(3)
# f is now a cli tool
f = aS(lambda x: x**2)
# returns 9, demonstrating that they act like normal functions
f(3)
# returns 9, demonstrating that you can also pipe into them
3 | f

Here, aS is pretty much the simplest cli available. It just makes whatever function you give it pipe-able, as you can’t quite pipe things to lambda functions in vanilla Python.

You can think of the flow of these clis in terms of 2 phases. 1 is configuring what you want the cli to do, and 2 is actually executing it. Let’s say you want to take a list of numbers and take the square of them:

# configuration stage. You provide a function to `apply` to tell it what function to apply to each element in the list, kinda like Python's "map" function
f = apply(lambda x: x**2)
# initialize the input
x = range(5)
# execution stage, normal style, returns [0, 1, 4, 9, 16]
list(f(x))
# execution stage, pipe style, returns [0, 1, 4, 9, 16]
list(x | f)

# typical usage: combining configuration stage and execution stage, returns [0, 1, 4, 9, 16]
list(range(5) | apply(lambda x: x**2))
# refactor converting to list so that it uses pipes, returns [0, 1, 4, 9, 16]
range(5) | apply(lambda x: x**2) | aS(list)

You may wonder why do we have to turn it into a list. That’s because all cli tools execute things lazily, so they will return iterators, instead of lists. Here’s how iterators work:

def gen(): # this is a generator, a special type of iterator. It generates elements
    yield 3
    print("after yielding 3")
    yield 2
    yield 5
for e in gen():
    print("in for loop:", e)

It will print this out:

in for loop: 3
after yielding 3
in for loop: 2
in for loop: 5

So, iterators feels like lists. In fact, a list is an iterator, range(5), numpy arrays and strings are also iterators. Basically anything that you can iterate through is an iterator. The above iterator is a little special, as it’s specifically called a “generator”. They are actually a really cool aspect of Python, in terms of they execute code lazily, meaning gen() won’t run all the way when you call it. In fact, it doesn’t run at all. Only once you request new elements when trying to iterate over it will the function run.

All cli tools utilize this fact, in terms of they will not actually execute anything unless you force them to:

# returns "<generator object apply.__ror__.<locals>.<genexpr> at 0x7f7ae48e4d60>"
range(5) | apply(lambda x: x**2)
# you can iterate through it directly:
for element in range(5) | apply(lambda x: x**2):
    print(element)
# returns [0, 1, 4, 9, 16], in case you want it in a list
list(range(5) | apply(lambda x: x**2))
# returns [0, 1, 4, 9, 16], demonstrating deref
range(5) | apply(lambda x: x**2) | deref()

In the first line, it returns a generator, instead of a normal list, as nothing has actually been executed. You can still iterate through generators using for loops as usual, or you can convert it into a list. When you get more advanced, and have iterators nested within iterators within iterators, you can use deref to turn all of them into lists.

Also, a lot of these tools (like apply and filt) sometimes assume that we are operating on a table. So this table:

col1

col2

col3

1

2

3

4

5

6

Is equivalent to this list:

[["col1", "col2", "col3"], [1, 2, 3], [4, 5, 6]]

Warning

If you’re not an advanced user, just skip this warning.

All cli tools should work fine with torch.Tensor, numpy.ndarray and pandas.core.series.Series, but k1lib actually modifies Numpy arrays and Pandas series deep down for it to work. This means that you can still do normal bitwise or with a numpy float value, and they work fine in all regression tests that I have, but you might encounter strange bugs. You can disable it manually by changing settings.startup.or_patch like this:

import k1lib
k1lib.settings.startup.or_patch.numpy = False
from k1lib.imports import *

If you choose to do this, you’ll have to be careful and use these workarounds:

torch.randn(2, 3, 5) | shape()                  # returns (2, 3, 5), works fine
np.random.randn(2, 3, 5) | shape()              # will not work, returns weird numpy array of shape (2, 3, 5)
shape()(np.random.randn(2, 3, 5))               # returns (2, 3, 5), mitigation strategy #1
[np.random.randn(2, 3, 5)] | (item() | shape()) # returns (2, 3, 5), mitigation strategy #2

Again, please note that you only need to do these workarounds if you choose to turn off C-type modifications. If you keep things by default, then all examples above should work just fine.

All cli-related settings are at settings.cli.

Argument expansion

I’d like to quickly mention the argument expansion motif that’s prominent in some cli tools. Check out this example:

[3, 5] | aS(lambda a: a[0] + a[1]) # returns 8, long version, not descriptive elements ("a[0]" and "a[1]")
[3, 5] | ~aS(lambda x, y: x + y) # returns 8, short version, descriptive elements ("x" and "y")

[[3, 5], [2, 7]] | apply(lambda a: a[0] + a[1]) | aS(list) # returns [8, 9], long version
[[3, 5], [2, 7]] | ~apply(lambda x, y: x + y) | aS(list) # returns [8, 9], short version

Here, the tilde operator (“~”, officially called “invert” in Python) used on aS and apply means that the input object/iterator will be expanded so that it fills all available arguments. This is a small quality-of-life feature, but makes a big difference, as parameters can now be named separately and nicely (“x” and “y”, which can convey that this is a coordinate of some sort, instead of “a[0]” and “a[1]”, which conveys nothing).

Inverting conditions

The tilde operator does not always mean expanding the arguments though. Sometimes it’s used for actually inverting the functionality of some clis:

range(5) |  filt(lambda x: x % 2 == 0) | aS(list) # returns [0, 2, 4]
range(5) | ~filt(lambda x: x % 2 == 0) | aS(list) # returns [1, 3]

[3, 5.5, "text"] | ~instanceOf(int) | aS(list) # returns [5.5, "text"]

Capturing operators

Some clis have the ability to “capture” the behavior of other clis and modify them on the fly. For example, let’s see tryout(), which catches errors in the pipeline and returns a default value if an error is raised:

"a3" | (tryout(4) | aS(int)) | op()*2 # returns 8, because int("a3") will throws an error, which will be caught, and the pipeline reduces down to 4*2
"3"  | (tryout(4) | aS(int)) | op()*2 # returns 6, because int("3") will not throw an error, and the pipeline effectively reduces down to int("3")*2
"3"  |  tryout(4) | aS(int)  | op()*2 # throws an error, because tryout() doesn't capture anything

Just a side note, op() will record all operations done on it, and it will replay those operations on anything that’s piped into it.

In the first line, tryout() | aS(int) will be executed first, which will lead to tryout() capturing all of the clis behind it and injecting in a try-catch code block to wrap all of them together. In the third line, it doesn’t work because "3" | tryout(4) is executed first, but here, tryout() doesn’t have the chance to capture the clis behind it, so it can’t inject a try-catch block around them. This also means that in the 1st and 2nd line, the final multify-by-2 step is not caught, because tryout() is bounded by the parentheses. If you’re composing this inside of another cli, then the scope is bounded by the outside cli:

range(5) | apply( tryout(-1) | op()**2)  | deref() # returns [0, 1, 4, 9, 16]. tryout() will capture op()**2
range(5) | apply((tryout(-1) | op()**2)) | deref() # returns [0, 1, 4, 9, 16], exactly the same as before, demonstrating that you don't have to wrap tryout() around another pair of braces

Cli composition

One of the very powerful things about this workflow is that you can easily combine cli tools together, to reach unfathomable levels of complexity while using very little code and still remain relatively readable. For example, this is an image dataloader built pretty much from scratch, but with full functionality comparable to PyTorch’s dataloaders:

base = "~/ssd/data/imagenet/set1/192px"
idxToCat = base | ls() | head(80) | op().split("/")[-1].all() | insertIdColumn() | toDict()
catToIdx = idxToCat.items() | permute(1, 0) | toDict()
# stage 1, (train/valid, classes, samples (url of img))
st1 = base | ls() | head(80) | apply(ls() | splitW()) | transpose() | deref() | aS(k1.Wrapper)
# stage 2, (train/valid, classes, samples, [img, class])
st2 = st1() | (apply(lambda x: [x | toImg() | toTensor(torch.uint8), catToIdx[x.split("/")[-2]]]) | repeatFrom(4) | apply(aS(tf.Resize(192)) | aS(tf.AutoAugment()) | op()/255, 0)).all(2) | deref() | aS(k1.Wrapper)
def dataF(bs): return st2() | apply(repeatFrom().all() | joinStreamsRandom() | batched(bs) | apply(transpose() | aS(torch.stack) + toTensor(torch.long))) | stagger.tv(10000/bs) | aS(list)

These 6 lines of code will read from a directory, grabs all images from the first 80 categories, splits them into train and valid sets. Then it will extend the data infinitely (so that we never run out of batches to train), load the images on multiple worker processes, do augmentations on them, renormalize them, batch them up, stack them together into a tensor, and split batches into multiple epochs.

All of that, from scratch, where you’re in control of every detail, operating in 7 dimensions, in multiple processes, in just 6 lines of code. This is just so ridiculously powerful that it boggles my mind every day. Yes, you can argue that it’s not clear what’s going on, but for a person that is already familiar with them like I do, seeing exactly how data is being transformed at every stage is quite straightforward and trivial.

Serial composition

So let’s see a few examples on how to compose clis together. Let’s say you have a list of files:

fileNames = ["a.txt", "b.txt", "c.txt"]

Let’s say you now want to read every line from every file quickly, using cli tools, and get the number of lines in each file. Instead of something like this:

sizes = []
for fileName in fileNames:
   sizes.append(cat(fileName) | shape(0)) # shape(0) is kinda like aS(len). It just returns the length of the input iterator, but difference is that aS(len) can only operate on lists

…which really defeats the purpose of the elegant cli workflow, you can do:

sizes = fileNames | apply(cat() | shape(0)) | aS(list)

In this example, there is 1 “composition”: cat() | shape(0). If you check out the docs for cat, which is used to read files, you’d know that there’re 2 modes of operation:

cat("a.txt") | shape(0) # mode 1: cat() acts like a function, returning a list of lines in the file
"a.txt" | cat() | shape(0) # mode 2: cat() acts like a cli tool, which will return a list of lines in the file when a file name is piped into it
"a.txt" | (cat() | shape(0)) # mode 2: cat() acts like a cli tool, "cat() | shape(0)" acts as a "serial" cli

s = cat() | shape(0); "a.txt" | s # equivalent to the 3rd line, but this time declaring "cat() | shape(0)" as a separate object

In the second case, "a.txt" | cat() will be executed first, then getting the number of elements will be executed later (... | shape(0)), but in the third case, cat() | shape(0) will be executed first, which returns the special cli serial, then the file name will be piped in later ("a.txt" | (...))

Because cli tools are also functions, which includes serial, you can pass them into other cli tools that expects a function, like apply. You can be extra meta, like this:

# assume a.txt, b.txt, c.txt has 10, 20, 30 lines
fileNames = [["a.txt"], ["b.txt", "c.txt"]]
# returns [[10], [20, 30]]
sizes = fileNames | apply(apply(cat() | shape(0)))
# also returns [[10], [20, 30]], and is equivalent to the line above, as "apply(apply(...))" is equivalent to "(...).all(2)"
sizes = fileNames | (cat() | shape(0)).all(2)

This type of composition is quite straightforward, unlike the next 2.

“&” composition, or “oneToMany”

Take a look at this example:

arr = ["a", "b", "c"]
arr | toRange()                       # returns range(3), equivalent to [0, 1, 2]
arr | iden()                          # returns ["a", "b", "c"]
arr | (toRange() & iden()) | aS(list) # returns [range(3), ["a", "b", "c"]]
arr | toRange() & iden() | aS(list)   # returns [range(3), ["a", "b", "c"]], demonstrating "&" will be executed before "|", so you don't need parentheses around it
arr | toRange() & iden() | joinStreams() | aS(list) # returns [0, 1, 2, "a", "b", "c"]

So, this will take the input iterator, duplicates into 2 versions, pipes them into the 2 clis you specified and return both of them. You can do this with as much clis as you want:

arr | toRange() &  shape() & grep("a")  | deref() # returns [[0, 1, 2], [3, 1], ["a"]]
arr | toRange() & (shape() & grep("a")) | deref() # also returns [[0, 1, 2], [3, 1], ["a"]], demonstrating a strange edge case that parentheses won't stop all clis adjacent to each other joined by "&" from combining together

Hopefully it now makes sense why it’s called “oneToMany”, as we’re making 1 iterator available for many clis. Also, if the exact cli operation is only known at run time, then you can procedurally do this using oneToMany.

“+” composition, or “mtmS”

Take a look at this example:

even = filt(lambda x: x % 2 == 0)
odd  = filt(lambda x: x % 2 == 1) # can also just be "~even", but I'm writing it out this way to be clear
[range(10, 20), range(30, 40)] | (even + odd) | deref()    # returns [[10, 12, 14, 16, 18], [31, 33, 35, 37, 39]]
[range(10, 20) | even, range(30, 40) | odd] | deref() # also returns [[10, 12, 14, 16, 18], [31, 33, 35, 37, 39]], demonstrating that these are equivalent to each other

So, let’s say that there’re n items inside of the input iterator and that you specified n clis. Then, each item will be piped into the corresponding cli, hence the name mtmS, or “manyToManySpecific”. Why not just “mtm”? Well, there used to be a “manyToMany” operator, but it’s been removed and I’m lazy to change it back.

Vanilla alternatives

These operations are not actually strictly necessary, they’re just convenience functions so that writing code is simpler and more straightforward. They can be implemented using normal clis like so:

a = iden()
b = apply(lambda x: x**2)
c = shape()

x = [[1, 2], [3, 4], [5, 6]]
x | a + b + c | deref()                                  # returns [[1, 2], [9, 16], [2]]
x | ~aS(lambda x, y, z: [x | a, y | b, z | c]) | deref() # returns [[1, 2], [9, 16], [2]]

x = range(5)
x | a & b & c | deref()                           # returns [[0, 1, 2, 3, 4], [0, 1, 4, 9, 16], [5]]
x | aS(lambda x: [x | a, x | b, x | c]) | deref() # returns [[0, 1, 2, 3, 4], [0, 1, 4, 9, 16], [5]]

So you might want to use these vanilla versions initially if you’re having a hard time with this, but I wouldn’t recommend using vanilla in the long term.

Philosophy

Just a short note: while I was developing this, the emphasis is on creating very succinct code that does a whole lot, to aid in exploring/creating datasets. Because of it, I’ve chosen to sacrifice readability. The idea is, if it’s so fast to create a functionality, whenever you need to change the code, it’ll be faster to just recreate it from scratch than try to change the existing code. And the mental effort to recreate it is substantially lower than the mental effort needed to understand a normal codebase written using vanilla Python. Also this encourages you to rethink the problem in a new light entirely, which usually results in much shorter and simpler code than if you were to adapt an existing solution. This seem to be true for me so far.

Note that creating unreadable, fantastically complicated code only happens around 5%. Majority of the time it’s actually very readable and I can change an obscure detail after 10 seconds. The way I usually do it is to “feel” what the data looks like, instead of trying to trace what it looks like from the very beginning. This is possible because certain functions has certain common signatures. For example, ~apply(lambda x,y: x+y, 3) probably means that it’s manipulating a table with the 3rd column being a list of 2 coordinate numbers. So, overtime, you’ll develop an intuition for what’s happenning and can visualize the data’s shape right in the middle of the pipeline.

Where to start?

Core clis include:

These clis are pretty important, and are used all the time, so look over them to see what the library can do. Whenever you find some cli you have not encountered before, you can just search it in the search bar on the top left of the page.

Then other important, not necessarily core clis include:

So, start reading over what these do first, as you can pretty much 95% utilize everything the cli workflow has to offer with those alone. Then skim over basic conversions in module conv. While you’re doing that, checkout trace(), for a quite powerful debugging tool.

There are several written tutorials about cli here, and I also made some video tutorials as well, so go check those out.

For every example in the tutorials that you found, you might find it useful to follow the following debugging steps, to see how everything works:

# assume there's this piece of code:
A | B | C | D
# do this instead:
A | deref()
# once you understand it, do this:
A | B | deref()

# assume there's this piece of code:
A | B.all() | C
# do this instead:
A | item() | B | deref()
# once you understand it, you can move on:
A | B.all() | deref()

# assume there's this piece of code:
A | B & C
# do this instead:
A | B | deref()

# assume there's this piece of code:
A | (B + C)
# do these instead:
A | deref() | op()[0] | B | deref()
A | deref() | op()[1] | C | dereF()
# there are alternatives to that:
A | item() | B | deref()
A | rows(1) | item() | C | deref()

Finally, you can read over the summary below, see what catches your eye and check that cli out.

Summary

structural

utils

conv

typehint

filt

transpose

size

toTensor

tBase

filt

reshape

shape

toRange

tAny

filter_

insert

item

toList

tList

inSet()

splitW

rItem()

toSum

tIter

contains()

splitC

iden

toProd

tSet

empty

joinStreams

join

toAvg

tCollection

isNumeric()

flatten

wrapList

toMean

tExpand

instanceOf()

joinStreamsRandom

equals

toMax

tNpArray

head

activeSamples

reverse

toMin

tTensor

tail()

table()

ignore

toPIL

tListIterSet()

cut

batched

rateLimit

toImg

tListSet()

rows

window

timeLimit

toRgb

tListIter()

intersection

groupBy

tab()

toRgba

tArrayTypes()

union

ungroup

indent()

toGray

inferType()

unique

insertColumn

clipboard

toDict

TypeHintException

breakIf

insertIdColumn()

deref

toFloat

tLowest()

mask

expandE

bindec

toInt

tCheck

tryout

unsqueeze()

smooth

toBytes

tOpt

count

disassemble()

toHtml

hist

tree()

toAscii()

permute

lookup

accumulate

dictFields

AA_

backup

peek

peekF

repeat

repeatF()

repeatFrom

oneHot

indexTable

modifier

inp

init

output

kxml

applyS

cat()

BaseCli

stdout

node

aS

splitSeek

Table

tee

maxDepth

apply

refineSeek

T()

file

tags

map_

curl()

fastF()

pretty

pretty

applyMp

wget()

yieldT()

display()

display

parallel

ls()

serial

headOut()

applyCl

cmd

oneToMany

intercept

applyTh

walk

mtmS

plotImgs

applySerial

requireCli()

sort

urlPath()

sortF

consume

randomize

stagger

op

integrate

nb

grep

kcsv

trace

optimizations

cells()

grep

cat()

trace

dummy()

pretty

grepTemplate

execute

Under the hood

How it works underneath is pretty simple. All cli tools implement the “reverse or” operation, or __ror__. So essentially, these 2 statements are equivalent:

3 | obj
obj.__ror__(3)

There are several other operations that certain clis can override, like “>” or “>>”. Also, if you’re an advanced user, there’s also an optimizer that looks like LLVM, so you can implement optimization passes to speed up everything by a lot:

Creating your own cli

It’s fairly simple to create your new cli. If it’s composed of other clis, you can do something like this:

newCli = filt(lambda x: x%2==0) | head(4) | deref()
range(10) | newCli # returns [0, 2, 4, 6]

If it’s more complicated that needs to have access to some state, like a sum of numbers, then you can extend from BaseCli like so:

class NewCli(BaseCli):
    def __init__(self, bias=0):
        self.bias = bias # don't necessarily have to call super.__init__()
    def __ror__(self, it):
        s = self.bias
        for elem in it:
            s += elem
         return s

[range(12, 30), range(8)] | NewCli(4).all() | deref() # returns [373, 32]

bio module

This is for functions that are actually biology-related

k1lib.cli.bio.go(term: int)[source]

Looks up a GO term

k1lib.cli.bio.quality(log=True)[source]

Get numeric quality of sequence. Example:

# returns [2, 2, 5, 30]
"##&?" | quality() | deref()
Parameters

log – whether to use log scale (0 -> 40), or linear scale (1 -> 0.0001)

k1lib.cli.bio.longFa()[source]

Takes in a fasta file and put each sequence on 1 line. File “gene.fa”:

>AF086833.2 Ebola virus - Mayinga, Zaire, 1976, complete genome
CGGACACACAAAAAGAAAGAAGAATTTTTAGGATC
TTTTGTGTGCGAATAACTATGAGGAAGATTAATAA
>something other gene
CGGACACACAAAAAGAAAGAAGA
TTTTGTGTGCGAATAACTATGAG

Code:

cat("gene.fa") | bio.longFa() | cli.headOut()

Prints out:

>AF086833.2 Ebola virus - Mayinga, Zaire, 1976, complete genome
CGGACACACAAAAAGAAAGAAGAATTTTTAGGATCTTTTGTGTGCGAATAACTATGAGGAAGATTAATAA
>something other gene
CGGACACACAAAAAGAAAGAAGATTTTGTGTGCGAATAACTATGAG
class k1lib.cli.bio.idx(fs: list = [])[source]

Bases: BaseCli

Indexes files with various formats.

static blast(fileName: Optional[str] = None, dbtype: Optional[str] = None)[source]

Uses makeblastdb to create a blast database from a fasta file. Example:

"file.fa" | bio.idx.blast()
bio.idx.blast("file.fa")
static bwa(fileName: Optional[str] = None)[source]

Uses bwa to index a fasta file. Example:

"file.fa" | bio.idx.bwa()
bio.idx.bwa("file.bwa")
static bam(fileName: Optional[str] = None)[source]

Uses samtools to index a bam file. Example:

"file.bam" | bio.idx.bam()
bio.idx.bam("file.bam")
class k1lib.cli.bio.transcribe(fs: list = [])[source]

Bases: BaseCli

Transcribes (DNA -> RNA) incoming rows. Example:

# returns "AUCG"
"ATCG" | transcribe()
# returns ["AUCG"]
["ATCG"] | transcribe() | deref()
__ror__(it: Union[Iterator[str], str])[source]
class k1lib.cli.bio.complement(fs: list = [])[source]

Bases: BaseCli

Get the reverse complement of DNA. Example:

# returns "TAGC"
"ATCG" | bio.complement()
# returns ["TAGC"]
["ATCG"] | bio.complement() | deref()
__ror__(it: Union[Iterator[str], str])[source]
class k1lib.cli.bio.translate(length: int = 0)[source]

Bases: BaseCli

__init__(length: int = 0)[source]

Translates incoming rows.

Parameters

length – 0 for short (L), 1 for med (Leu), 2 for long (Leucine)

__ror__(it: Iterator[str])[source]
class k1lib.cli.bio.medAa(fs: list = [])[source]

Bases: BaseCli

Converts short aa sequence to medium one

__ror__(it: Iterator[str])[source]
class k1lib.cli.bio.longAa(fs: list = [])[source]

Bases: BaseCli

Converts short aa sequence to long one

__ror__(it: Iterator[str])[source]

cif module

All tools related to cif file format that describes protein structures. Expected to use behind the “cif” module name, like this:

from k1lib.imports import *
cif.cat("abc.cif")
k1lib.cli.cif.tables(name=None, dikt=True)[source]

Loads table info. Dictionary mode:

# both return output below
"1z7z.cif" | cif.tables() | op()["_audit_author"]
"1z7z.cif" | cif.tables("_audit_author")

Potential output:

{'name': ("'Xiao, C.'",
  "'Bator-Kelly, C.M.'",
  "'Rieder, E.'",
  "'Chipman, P.R.'",
  "'Craig, A.'",
  "'Kuhn, R.J.'",
  "'Wimmer, E.'",
  "'Rossmann, M.G.'"),
 'pdbx_ordinal': ('1', '2', '3', '4', '5', '6', '7', '8')}

Result is a dictionary of table name -> dict(). That inner dictionary maps from column name to a list of elements. All columns should have the same number of elements.

Table mode:

# both return output below
"1z7z.cif" | cif.tables("_audit_author", dikt=False)
"1z7z.cif" | cif.tables(dikt=False) | op()["_audit_author"]

Potential output:

[['name', 'pdbx_ordinal'],
 ["'Xiao, C.'", '1'],
 ["'Bator-Kelly, C.M.'", '2'],
 ["'Rieder, E.'", '3'],
 ["'Chipman, P.R.'", '4'],
 ["'Craig, A.'", '5'],
 ["'Kuhn, R.J.'", '6'],
 ["'Wimmer, E.'", '7'],
 ["'Rossmann, M.G.'", '8']]

Result is a dictionary of table name -> List[List[str]]. So basically you’re getting the table directly.

Parameters
  • name – if specified, only grabs the specified table, else returns every table

  • dikt – whether to return a dict or table for each table

k1lib.cli.cif.records()[source]

Load record info. Example:

"1z7z.cif" | cif.records() | op()["_exptl"] | deref()

Potential output:

[['entry_id', '1Z7Z'],
 ['method', "'ELECTRON MICROSCOPY'"],
 ['crystals_number', '?']]

Result is a dictionary of record name -> (n, 2) table

conv module

This is for all short utilities that converts from 1 data type to another. They might feel they have different styles, as toFloat converts object iterator to float iterator, while toPIL converts single image url to single PIL image, whereas toSum converts float iterator into a single float value.

The general convention is, if the intended operation sounds simple (convert to floats, strings, types, …), then most likely it will convert iterator to iterator, as you can always use the function directly if you only want to apply it on 1 object.

If it sounds complicated (convert to PIL image, tensor, …) then most likely it will convert object to object. Lastly, there are some that just feels right to input an iterator and output a single object (like getting max, min, std, mean values).

class k1lib.cli.conv.toTensor(dtype=torch.float32)[source]

Bases: BaseCli

__init__(dtype=torch.float32)[source]

Converts generator to torch.Tensor. Essentially torch.tensor(list(it)).

Also checks if input is a PIL Image. If yes, turn it into a torch.Tensor and return.

__ror__(it: Iterator[float]) Tensor[source]
class k1lib.cli.conv.toRange[source]

Bases: BaseCli

__init__()[source]

Returns iter(range(len(it))), effectively. Example:

# returns [0, 1, 2]
[3, 2, 5] | toRange() | deref()
__ror__(it: Iterator[Any]) Iterator[int][source]
class k1lib.cli.conv.toList[source]

Bases: BaseCli

__init__()[source]

Converts generator to list. Example:

# returns [0, 1, 2, 3, 4]
range(5) | toList()
# returns [0, 1, 2, 3, 4]
range(5) | aS(list)

So this cli is sort of outdated. It still works fine, nothing wrong with it, but just do aS(list) instead. It’s not removed to avoid breaking old projects.

__ror__(it: Iterator[Any]) List[Any][source]
class k1lib.cli.conv.toSum[source]

Bases: BaseCli

__init__()[source]

Calculates the sum of list of numbers. Can pipe in torch.Tensor or numpy.ndarray. Example:

# returns 45
range(10) | toSum()
__ror__(it: Iterator[float])[source]
class k1lib.cli.conv.toProd[source]

Bases: BaseCli

__init__()[source]

Calculates the product of a list of numbers. Can pipe in torch.Tensor or numpy.ndarray. Example:

# returns 362880
range(1,10) | toProd()
__ror__(it)[source]
class k1lib.cli.conv.toAvg[source]

Bases: BaseCli

__init__()[source]

Calculates average of list of numbers. Can pipe in torch.Tensor or numpy.ndarray. Example:

# returns 4.5
range(10) | toAvg()
# returns nan
[] | toAvg()
__ror__(it: Iterator[float])[source]
k1lib.cli.conv.toMean

alias of toAvg

class k1lib.cli.conv.toMax[source]

Bases: BaseCli

__init__()[source]

Calculates the max of a bunch of numbers. Can pipe in torch.Tensor or numpy.ndarray. Example:

# returns 6
[2, 5, 6, 1, 2] | toMax()
__ror__(it: Iterator[float]) float[source]
class k1lib.cli.conv.toMin[source]

Bases: BaseCli

__init__()[source]

Calculates the min of a bunch of numbers. Can pipe in torch.Tensor or numpy.ndarray. Example:

# returns 1
[2, 5, 6, 1, 2] | toMin()
__ror__(it: Iterator[float]) float[source]
class k1lib.cli.conv.toPIL(closeFig=True, crop=True)[source]

Bases: BaseCli

__init__(closeFig=True, crop=True)[source]

Converts multiple data types into a PIL image. Example:

# grabs first image in the current folder
ls(".") | toPIL().all() | item()
# converts from tensor/array to image
torch.randn(100, 200) | toPIL()
# grabs image, converts to byte stream, and converts back to image
"abc.jpg" | toPIL() | toBytes() | toPIL()
# converts paragraphs to image
["abc", "def"] | toPIL()
# converts SMILES string to molecule, then to image
"c1ccc(C)cc1" | toMol() | toImg()

You can also save a matplotlib figure by piping in a matplotlib.figure.Figure object:

x = np.linspace(0, 4)
plt.plot(x, x**2)
plt.gcf() | toPIL()

Note

If you are working with image tensors, which is typically have dimensions of (C, H, W), you have to permute it to PIL’s (H, W, C) first before passing it into this cli.

Also it’s expected that your tensor image ranges from 0-255, and not 0-1. Make sure you renormalize it

Parameters
  • closeFig – if input is a matplotlib figure, then closes the figure after generating the image

  • crop – whether to crop white spaces around an image or not

__ror__(path) Image[source]
k1lib.cli.conv.toImg

alias of toPIL

class k1lib.cli.conv.toRgb[source]

Bases: BaseCli

__init__()[source]

Converts greyscale/rgb PIL image to rgb image. Example:

# reads image file and converts it to rgb
"a.png" | toPIL() | toRgb()
__ror__(i)[source]
class k1lib.cli.conv.toRgba[source]

Bases: BaseCli

__init__()[source]

Converts random PIL image to rgba image. Example:

# reads image file and converts it to rgba
"a.png" | toPIL() | toRgba()
__ror__(i)[source]
class k1lib.cli.conv.toGray[source]

Bases: BaseCli

__init__()[source]

Converts random PIL image to a grayscale image. Example:

# reads image file and converts it to rgba
"a.png" | toPIL() | toGray()
__ror__(i)[source]
class k1lib.cli.conv.toDict(rows=True)[source]

Bases: BaseCli

__init__(rows=True)[source]

Converts 2 Iterators, 1 key, 1 value into a dictionary. Example:

# returns {1: 3, 2: 4}
[[1, 3], [2, 4]] | toDict()
# returns {1: 3, 2: 4}
[[1, 2], [3, 4]] | toDict(False)

If rows is a string, then it will build a dictionary from key-value pairs delimited by this character. For example:

['gene_id "ENSG00000290825.1"',
 'transcript_id "ENST00000456328.2"',
 'gene_type "lncRNA"',
 'gene_name "DDX11L2"',
 'transcript_type "lncRNA"',
 'transcript_name "DDX11L2-202"',
 'level 2',
 'transcript_support_level "1"',
 'tag "basic"',
 'tag "Ensembl_canonical"',
 'havana_transcript "OTTHUMT00000362751.1"'] | toDict(" ")

That returns:

{'gene_id': '"ENSG00000290825.1"',
 'transcript_id': '"ENST00000456328.2"',
 'gene_type': '"lncRNA"',
 'gene_name': '"DDX11L2"',
 'transcript_type': '"lncRNA"',
 'transcript_name': '"DDX11L2-202"',
 'level': '2',
 'transcript_support_level': '"1"',
 'tag': '"Ensembl_canonical"',
 'havana_transcript': '"OTTHUMT00000362751.1"'}
Params rows

if True, reads input in row by row, else reads in list of columns

__ror__(it: Tuple[Iterator[T], Iterator[T]]) dict[source]
class k1lib.cli.conv.toFloat(*columns, mode=2)[source]

Bases: BaseCli

__init__(*columns, mode=2)[source]

Converts every row into a float. Example:

# returns [1, 3, -2.3]
["1", "3", "-2.3"] | toFloat() | deref()
# returns [[1.0, 'a'], [2.3, 'b'], [8.0, 'c']]
[["1", "a"], ["2.3", "b"], [8, "c"]] | toFloat(0) | deref()

With weird rows:

# returns [[1.0, 'a'], [8.0, 'c']]
[["1", "a"], ["c", "b"], [8, "c"]] | toFloat(0) | deref()
# returns [[1.0, 'a'], [0.0, 'b'], [8.0, 'c']]
[["1", "a"], ["c", "b"], [8, "c"]] | toFloat(0, force=True) | deref()

This also works well with torch.Tensor and numpy.ndarray, as they will not be broken up into an iterator:

# returns a numpy array, instead of an iterator
np.array(range(10)) | toFloat()
Parameters
  • columns – if nothing, then will convert each row. If available, then convert all the specified columns

  • mode – different conversion styles - 0: simple float() function, fastest, but will throw errors if it can’t be parsed - 1: if there are errors, then replace it with zero - 2: if there are errors, then eliminate the row

__ror__(it)[source]
class k1lib.cli.conv.toInt(*columns, mode=2)[source]

Bases: BaseCli

__init__(*columns, mode=2)[source]

Converts every row into an integer. Example:

# returns [1, 3, -2]
["1", "3", "-2.3"] | toInt() | deref()
Parameters
  • columns – if nothing, then will convert each row. If available, then convert all the specified columns

  • mode – different conversion styles - 0: simple float() function, fastest, but will throw errors if it can’t be parsed - 1: if there are errors, then replace it with zero - 2: if there are errors, then eliminate the row

See also: toFloat()

__ror__(it)[source]
class k1lib.cli.conv.toBytes(imgType='JPEG')[source]

Bases: BaseCli

__init__(imgType='JPEG')[source]

Converts several object types to bytes. Example:

# converts string to bytes
"abc" | toBytes()
# converts image to base64 bytes
torch.randn(200, 100) | toImg() | toBytes()
Parameters

imgType – if input is an image then this is the image type. Can change to “PNG” or sth like that

__ror__(it)[source]
class k1lib.cli.conv.toHtml[source]

Bases: BaseCli

__init__()[source]

Converts several object types to bytes. Example:

# converts PIL image to html <img> tag
torch.randn(200, 100) | toImg() | toHtml()
__ror__(it)[source]
k1lib.cli.conv.toAscii()[source]

Converts complex unicode text to its base ascii form. Example:

"hà nội" | toAscii() # returns "ha noi"

Taken from https://stackoverflow.com/questions/2365411/convert-unicode-to-ascii-without-errors-in-python

mgi module

All tools related to the MGI database. Expected to use behind the “mgi” module name, like this:

from k1lib.imports import *
["SOD1", "AMPK"] | mgi.batch()
class k1lib.cli.mgi.batch(headless=True)[source]

Bases: BaseCli

Queries MGI database, convert list of genes to MGI ids

__init__(headless=True)[source]
Parameters

headless – whether to run this operation headless, or actually display the browser

__ror__(it: List[str])[source]

filt module

This is for functions that cuts out specific parts of the table

class k1lib.cli.filt.filt(predicate: Callable[[T], bool], column: Optional[int] = None, catchErrors: bool = False)[source]

Bases: BaseCli

__init__(predicate: Callable[[T], bool], column: Optional[int] = None, catchErrors: bool = False)[source]

Filters out elements. Examples:

# returns [2, 6], grabbing all the even elements
[2, 3, 5, 6] | filt(lambda x: x%2 == 0) | deref()
# returns [3, 5], grabbing all the odd elements
[2, 3, 5, 6] | ~filt(lambda x: x%2 == 0) | deref()
# returns [[2, 'a'], [6, 'c']], grabbing all the even elements in the 1st column
[[2, "a"], [3, "b"], [5, "a"], [6, "c"]] | filt(lambda x: x%2 == 0, 0) | deref()
# throws error, because strings can't mod divide
[1, 2, "b", 8] | filt(lambda x: x % 2 == 0) | deref()
# returns [2, 8]
[1, 2, "b", 8] | filt(lambda x: x % 2 == 0, catchErrors=True) | deref()

You can also pass in op, for extra intuitiveness:

# returns [2, 6]
[2, 3, 5, 6] | filt(op() % 2 == 0) | deref()
# returns ['abc', 'a12']
["abc", "def", "a12"] | filt(op().startswith("a")) | deref()
# returns [3, 4, 5, 6, 7, 8, 9]
range(100) | filt(3 <= op() < 10) | deref()

If you pass in numpy.ndarray or torch.Tensor, then it will automatically use the C-accelerated versions if possible, like this:

# returns np.array([2, 3, 4]), instead of iter([2, 3, 4])
np.array([1, 2, 3, 4]) | filt(lambda x: x>=2) | deref()
# returns [2, 3, 4], instead of np.array([2, 3, 4]), because `math.exp` can't operate on numpy arrays
np.array([1, 2, 3, 4]) | filt(lambda x: math.exp(x) >= 3) | deref()

If you need more extensive filtering capabilities involving text, check out grep

If “filt” is too hard to remember, this cli also has an alias filter_ that kinda mimics Python’s filter().

Parameters
  • predicate – function that returns True or False

  • column – if not specified, then filters elements of the input array, else filters the specific column only

  • catchErrors – whether to catch errors in the function or not (reject elements that raise errors). Runs slower if enabled though

__ror__(it: Iterator[T]) Iterator[T][source]
__invert__()[source]

Negate the condition

split()[source]

Splits the input into positive and negative samples. Example:

# returns [[0, 2, 4, 6, 8], [1, 3, 5, 7, 9]]
range(10) | filt(lambda x: x%2 == 0).split() | deref()
# also returns [[0, 2, 4, 6, 8], [1, 3, 5, 7, 9]], exactly like above
range(10) | filt(lambda x: x%2 == 0) & filt(lambda x: x%2 != 0) | deref()
k1lib.cli.filt.filter_

alias of filt

k1lib.cli.filt.inSet(values: Set[Any], column: Optional[int] = None) filt[source]

Filters out lines that is not in the specified set. Example:

# returns [2, 3]
range(5) | inSet([2, 8, 3]) | deref()
# returns [0, 1, 4]
range(5) | ~inSet([2, 8, 3]) | deref()
k1lib.cli.filt.contains(s: str, column: Optional[int] = None) filt[source]

Filters out lines that don’t contain the specified substring. Sort of similar to grep, but this is simpler, and can be inverted. Example:

# returns ['abcd', '2bcr']
["abcd", "0123", "2bcr"] | contains("bc") | deref()
class k1lib.cli.filt.empty(reverse=False)[source]

Bases: BaseCli

__init__(reverse=False)[source]

Filters out streams that is not empty. Almost always used inverted, but “empty” is a short, sweet name that’s easy to remember. Example:

# returns [[1, 2], ['a']]
[[], [1, 2], [], ["a"]] | ~empty() | deref()
Parameters

reverse – not intended to be used by the end user. Do ~empty() instead.

__ror__(streams: Iterator[Iterator[T]]) Iterator[Iterator[T]][source]
__invert__()[source]
k1lib.cli.filt.isNumeric(column: Optional[int] = None) filt[source]

Filters out a line if that column is not a number. Example:

# returns [0, 2, '3']
[0, 2, "3", "a"] | isNumeric() | deref()
k1lib.cli.filt.instanceOf(cls: Union[type, Tuple[type]], column: Optional[int] = None) filt[source]

Filters out lines that is not an instance of the given type. Example:

# returns [2]
[2, 2.3, "a"] | instanceOf(int) | deref()
# returns [2, 2.3]
[2, 2.3, "a"] | instanceOf((int, float)) | deref()
class k1lib.cli.filt.head(n=10)[source]

Bases: BaseCli

__init__(n=10)[source]

Only outputs first n elements. You can also negate it (like ~head(5)), which then only outputs after first n lines. Examples:

"abcde" | head(2) | deref() # returns ["a", "b"]
"abcde" | ~head(2) | deref() # returns ["c", "d", "e"]
"0123456" | head(-3) | deref() # returns ['0', '1', '2', '3']
"0123456" | ~head(-3) | deref() # returns ['4', '5', '6']
"012" | head(None) | deref() # returns ['0', '1', '2']
"012" | ~head(None) | deref() # returns []

You can also pass in fractional head:

range(20) | head(0.25) | deref() # returns [0, 1, 2, 3, 4], or the first 25% of samples

Also works well and fast with numpy.ndarray, torch.Tensor and other sliceable types:

# returns (10,)
np.linspace(1, 3) | head(10) | shape()
__ror__(it: Iterator[T]) Iterator[T][source]
__invert__()[source]
split()[source]

Splits the list up into a head and tail sections. Example:

# returns [[0, 1, 2, 3], [4, 5, 6, 7, 8, 9]]
range(10) | head(4).split() | deref()

This only splits it into 2 parts. If you want to split it up into many more parts with specified checkpoints, check out splitC.

k1lib.cli.filt.tail(n: int = 10)[source]

Basically an inverted head. Examples:

range(10) | tail(3) | deref() # returns [7, 8, 9]
class k1lib.cli.filt.cut(*columns: List[int])[source]

Bases: BaseCli

__init__(*columns: List[int])[source]

Cuts out specific columns, sliceable. Examples:

["0123456789", "abcdefghij"] | cut(5, 8) | deref() # returns [['5', '8'], ['f', 'i']]
["0123456789", "abcdefghij"] | cut(8, 5) | deref() # returns [['8', '5'], ['i', 'f']], demonstrating permutation-safe
["0123456789"] | cut(5, 8) | deref() # returns [['5', '8']]
["0123456789"] | cut(8, 5) | deref() # returns [['8', '5']], demonstrating permutation-safe
["0123456789", "abcdefghij"] | cut(2) | deref() # returns ['2', 'c'], instead of [['2'], ['c']] as usual
["0123456789"] | cut(2) | deref() # returns ['2']
["0123456789"] | cut(5, 8) | deref() # returns [['5', '8']]
["0123456789"] | ~cut()[:7:2] | deref() # returns [['1', '3', '5', '7', '8', '9']]

In the first example, you can imagine that we’re operating on this table:

0123456789
abcdefghij

Then, we want to grab the 5th and 8th column (0-indexed), which forms this table:

58
fi

So, result of that is just [['5', '8'], ['f', 'i']]

In the fourth example, if you’re only cutting out 1 column, then it will just grab that column directly, instead of putting it in a list.

If you pass in numpy.ndarray or torch.Tensor, then it will automatically use the C-accelerated versions, like this:

torch.randn(4, 5, 6) | cut(2, 3)  # returns tensor of shape (4, 2, 6)
torch.randn(4, 5, 6) | cut(2)     # returns tensor of shape (4, 6)
torch.randn(4, 5, 6) | ~cut()[2:] # returns tensor of shape (4, 2, 6)

Warning

TD;DR: inverted negative indexes are a bad thing when rows don’t have the same number of elements

Everything works fine when all of your rows have the same number of elements. But things might behave a little strangely if they don’t. For example:

# returns [['2', '3', '4'], ['2', '3', '4', '5', '6', '7']]. Different number of columns, works just fine
["0123456", "0123456789"]    |  cut()[2:-2] | deref()
# returns [['0', '1', '8', '9'], ['a', 'b', 'i', 'j']]. Same number of columns, works just fine
["0123456789", "abcdefghij"] | ~cut()[2:-2] | deref()
# returns [['0', '1', '5', '6'], ['0', '1', '5', '6', '7', '8', '9']]. Different number of columns, unsupported invert case
["0123456", "0123456789"]    | ~cut()[2:-2] | deref()

Why does this happen? It peeks at the first row, determines that ~[2:-2] is equivalent to [:2] and [5:] combined and not [:2] and [-2:] combined. When applied to the second row, [-2:] goes from 5->9, hence the result. Another edge case would be:

# returns [['0', '1', '2', '3', '5', '6'], ['0', '1', '2', '3', '5', '6', '7', '8', '9']]
["0123456", "0123456789"] | ~cut(-3) | deref()

Like before, it peeks the first row and translate ~(-3) into ~4, which is equivalent to [:4] and [5:]. But when applied to the second row, it now carries the meaning ~4, instead of ~(-3).

Why don’t I just fix these edge cases? Because the run time for it would be completely unacceptable, as we’d have to figure out what’s the columns to include in the result for every row. This could easily be O(n^3). Of course, with more time optimizing, this could be solved, but this is the only extreme edge case and I don’t feel like putting in the effort to optimize it.

__ror__(it: Table[T]) Table[T][source]
__invert__()[source]
class k1lib.cli.filt.rows(*rows: List[int])[source]

Bases: BaseCli

__init__(*rows: List[int])[source]

Selects specific elements given an iterator of indexes. Space complexity O(1) as a list is not constructed (unless you’re slicing it in really weird way). Example:

"0123456789" | rows(2) | toList() # returns ["2"]
"0123456789" | rows(5, 8) | toList() # returns ["5", "8"]
"0123456789" | rows()[2:5] | toList() # returns ["2", "3", "4"]
"0123456789" | ~rows()[2:5] | toList() # returns ["0", "1", "5", "6", "7", "8", "9"]
"0123456789" | ~rows()[:7:2] | toList() # returns ['1', '3', '5', '7', '8', '9']
"0123456789" | rows()[:-4] | toList() # returns ['0', '1', '2', '3', '4', '5']
"0123456789" | ~rows()[:-4] | toList() # returns ['6', '7', '8', '9']

Why it’s called “rows” is because I couldn’t find a good name for it. There was cut, which the name of an actual bash cli that selects out columns given indicies. When I needed a way to do what this cli does, it was in the context of selecting out rows, so the name stuck.

If you want to just pick out the nth item from the iterator, instead of doing this:

iter(range(10)) | rows(3) | item() # returns 3

… you can use the shorthand rItem instead:

iter(range(10)) | rItem(3) # returns 3
Parameters

rows – ints for the row indices

__invert__()[source]
__ror__(it: Iterator[str])[source]
class k1lib.cli.filt.intersection(column=None)[source]

Bases: BaseCli

__init__(column=None)[source]

Returns the intersection of multiple streams. Example:

# returns set([2, 4, 5])
[[1, 2, 3, 4, 5], [7, 2, 4, 6, 5]] | intersection()
# returns ['2g', '4h', '5j']
[["1a", "2b", "3c", "4d", "5e"], ["7f", "2g", "4h", "6i", "5j"]] | intersection(0) | deref()
Parameters

column – what column to apply the intersection on. Defaulted to None

__ror__(its: Iterator[Iterator[Any]]) Set[Any][source]
class k1lib.cli.filt.union[source]

Bases: BaseCli

__init__()[source]

Returns the union of multiple streams. Example:

# returns {0, 1, 2, 10, 11, 12, 13, 14}
[range(3), range(10, 15)] | union()
__ror__(its: Iterator[Iterator[Any]]) Set[Any][source]
class k1lib.cli.filt.unique(column: Optional[int] = None)[source]

Bases: BaseCli

__init__(column: Optional[int] = None)[source]

Filters out non-unique row elements. Example:

# returns [[1, "a"], [2, "a"]]
[[1, "a"], [2, "a"], [1, "b"]] | unique(0) | deref()
# returns [0, 1, 2, 3, 4]
[*range(5), *range(3)] | unique() | deref()

In the first example, because the 3rd element’s first column is 1, which has already appeared, so it will be filtered out.

Parameters

column – the column to detect unique elements. Can be None, which will behave like converting the input iterator into a set, but this cli will maintain the order

__ror__(it: Table[T]) Table[T][source]
class k1lib.cli.filt.breakIf(f)[source]

Bases: BaseCli

__init__(f)[source]

Breaks the input iterator if a condition is met. Example:

# returns [0, 1, 2, 3, 4, 5]
[*range(10), 2, 3] | breakIf(lambda x: x > 5) | deref()
__ror__(it: Iterator[T]) Iterator[T][source]
class k1lib.cli.filt.mask(mask: Iterator[bool])[source]

Bases: BaseCli

__init__(mask: Iterator[bool])[source]

Masks the input stream. Example:

# returns [0, 1, 3]
range(5) | mask([True, True, False, True, False]) | deref()
# returns torch.tensor([0, 1, 3])
torch.tensor(range(5)) | mask([True, True, False, True, False])
__ror__(it)[source]
class k1lib.cli.filt.tryout(result=None)[source]

Bases: BaseCli

end = <object object>
__init__(result=None)[source]

Wraps every cli operation after this in a try-catch block, returning result. This can be a little finicky. Example:

# returns 9
3 | (tryout("failed") | op()**2)
# returns "failed", instead of raising an exception
"3" | (tryout("failed") | op()**2)
# returns "unsupported operand type(s) for ** or pow(): 'str' and 'int'"
"3" | (tryout(Exception) | op()**2)

By default, this tryout() object will gobble up all clis behind it and wrap them inside a try-catch block. This might be undesirable, so you can stop it early:

# returns "failed"
3 | (tryout("failed") | op()**2 | aS(str) | op()**2)
# raises an exception, because it does not errors after `tryout.end`
3 | (tryout("failed") | op()**2 | tryout.end | aS(str) | op()**2)
Parameters

result – result to return if there is an exception. If passed in the class Exception, then will return the exception’s string instead

__ror__(it)[source]

gb module

All tools related to GenBank file format. Expected to use behind the “gb” module name, like this:

from k1lib.imports import *
cat("abc.gb") | gb.feats()
class k1lib.cli.gb.feats(fs: list = [])[source]

Bases: BaseCli

Fetches features, each on a separate stream. Example:

cat("a.gb") | gb.feats()

Output example:

[['     source          1..248956422',
  '                     /organism="Homo sapiens"',
  '                     /mol_type="genomic DNA"',
  '                     /db_xref="taxon:9606"',
  '                     /chromosome="1"'],
 ['     gene            11874..14409',
  '                     /gene="DDX11L1"',
  '                     /note="DEAD/H-box helicase 11 like 1 (pseudogene); Derived',
  '                     by automated computational analysis using gene prediction',
  '                     method: BestRefSeq."',
  '                     /pseudo',
  '                     /db_xref="GeneID:100287102"',
  '                     /db_xref="HGNC:HGNC:37102"']]
__ror__(it)[source]
static filt(*terms: str) BaseCli[source]

Filters for specific terms in all the features texts. If there are multiple terms, then filters for first term, then second, then third, so the term’s order might matter to you. Example:

[['     source          1..248956422',
  '                     /organism="Homo sapiens"',
  '                     /mol_type="genomic DNA"',
  '                     /db_xref="taxon:9606"',
  '                     /chromosome="1"'],
 ['     gene            11874..14409',
  '                     /gene="DDX11L1"',
  '                     /note="DEAD/H-box helicase 11 like 1 (pseudogene); Derived',
  '                     by automated computational analysis using gene prediction',
  '                     method: BestRefSeq."',
  '                     /pseudo',
  '                     /db_xref="GeneID:100287102"',
  '                     /db_xref="HGNC:HGNC:37102"']] | gb.feats.filt("mol_type")

Output:

[['     source          1..248956422',
  '                     /organism="Homo sapiens"',
  '                     /mol_type="genomic DNA"',
  '                     /db_xref="taxon:9606"',
  '                     /chromosome="1"']]
static root() BaseCli[source]

Gets root (top most unnamed tag) of a feature. Example:

['     misc_RNA        complement(join(14362..14829,14970..15038,15796..15947,',
 '                     16607..16765,16858..17055,17233..17368,17606..17742,',
 '                     17915..18061,18268..18366,24738..24891,29321..29370))',
 '                     /gene="WASH7P"',
 '                     /gene_synonym="FAM39F; WASH5P"',
 '                     /product="WASP family homolog 7, pseudogene"',
 '                     /note="Derived by automated computational analysis using',
 '                     gene prediction method: BestRefSeq."',
 '                     /pseudo',
 '                     /transcript_id="NR_024540.1"',
 '                     /db_xref="GeneID:653635"',
 '                     /db_xref="HGNC:HGNC:38034"'] | feats.root()

Output:

['misc_RNA',
 ['complement(join(14362..14829,14970..15038,15796..15947,',
  '16607..16765,16858..17055,17233..17368,17606..17742,',
  '17915..18061,18268..18366,24738..24891,29321..29370))']]
static tags(*tags: List[str]) BaseCli[source]

Grabs a list of tags. Example:

s = ['     misc_RNA        complement(join(14362..14829,14970..15038,15796..15947,',
     '                     16607..16765,16858..17055,17233..17368,17606..17742,',
     '                     17915..18061,18268..18366,24738..24891,29321..29370))',
     '                     /gene="WASH7P"',
     '                     /gene_synonym="FAM39F; WASH5P"',
     '                     /product="WASP family homolog 7, pseudogene"',
     '                     /note="Derived by automated computational analysis using',
     '                     gene prediction method: BestRefSeq."',
     '                     /pseudo',
     '                     /transcript_id="NR_024540.1"',
     '                     /db_xref="GeneID:653635"',
     '                     /db_xref="HGNC:HGNC:38034"']
s | feats.tags()

Output:

[['gene', 'WASH7P'],
 ['gene_synonym', 'FAM39F; WASH5P'],
 ['product', 'WASP family homolog 7, pseudogene'],
 ['note',
  'Derived by automated computational analysis using gene prediction method: BestRefSeq.'],
 ['pseudo', ''],
 ['transcript_id', 'NR_024540.1'],
 ['db_xref', 'GeneID:653635'],
 ['db_xref', 'HGNC:HGNC:38034']]

With filters:

# returns [['gene', 'WASH7P'], ['db_xref', 'HGNC:HGNC:38034'], ['organism', '']]
s | feats.tags("gene", "db_xref", "organism")
class k1lib.cli.gb.origin(fs: list = [])[source]

Bases: BaseCli

Return the origin section of the genbank file. Example:

# returns single fasta string
cat("a.gb") | gb.origin()
__ror__(it)[source]

grep module

class k1lib.cli.grep.grep(pattern: Union[str, Callable[[Any], bool]], before: int = 0, after: int = 0, N: int = inf, sep: bool = False, col: Optional[int] = None)[source]

Bases: BaseCli

__init__(pattern: Union[str, Callable[[Any], bool]], before: int = 0, after: int = 0, N: int = inf, sep: bool = False, col: Optional[int] = None)[source]

Find lines that has the specified pattern. Example:

# returns ['d', 'd']
"abcde12d34" | grep("d") | deref()
# returns ['c', 'd', '2', 'd'], 2 sections of ['c', 'd'] and ['2', 'd']
"abcde12d34" | grep("d", 1) | deref()
# returns ['c', 'd']
"abcde12d34" | grep("d", 1, N=1) | deref()
# returns ['d', 'e', 'd', '3', '4'], 2 sections of ['d', 'e'] and ['d', '3', '4']
"abcde12d34" | grep("d", 0, 3).till("e") | deref()
# returns [['0', '1', '2'], ['3', '1', '4']]
"0123145" | grep("1", 2, 1, sep=True) | deref()

You can also separate out the sections:

# returns [['c', 'd'], ['2', 'd']]
"abcde12d34" | grep("d", 1, sep=True) | deref()
# returns [['c', 'd']]
"abcde12d34" | grep("d", 1, N=1, sep=True) | deref()
# returns [['1', '2', '3'], ['1', '4', '5']]
"0123145" | grep("1", sep=True).till() | deref()

You can also put in predicates instead of regex patterns:

# returns ['d', 'd']
"abcde12d34" | grep(lambda x: x == "d") | deref()
# also returns ['d', 'd']
"abcde12d34" | filt(lambda x: x == "d") | deref()
# returns ['d', 'e', 'd', '3', '4']
"abcde12d34" | grep(lambda x: x == "d").till(lambda x: x == "e") | deref()

The first scenario looks like a regular filter function, already implemented by filt, but grep brings in more clustering features for the price of reduced execution speed. So for simple scenarios it’s advised that you use filt.

See also: groupBy

Also, there’s a whole tutorial devoted to just this cli

Also also, if each element in the input iterator is not a string/bytes, and you’re searching using regex, then it will get its representation and searches in it.

Parameters
  • pattern – regex pattern to search for in a line

  • before – lines before the hit. Outputs independent lines

  • after – lines after the hit. Outputs independent lines

  • N – max sections to output

  • sep – whether to separate out the sections as lists

  • col – searches for pattern in a specific column

till(pattern: Optional[Union[str, Callable[[Any], bool]]] = None)[source]

Greps until some other pattern appear. Inclusive, so you might want to trim the last line. Example:

# returns ['5', '6', '7', '8'], includes last item
range(10) | join("") | grep("5").till("8") | deref()
# returns ['d', 'e', 'd', '3', '4']
"abcde12d34" | grep("d").till("e") | deref()
# returns ['d', 'e']
"abcde12d34" | grep("d", N=1).till("e") | deref()

If initial pattern and till pattern are the same, then you don’t have use this method at all. Instead, do something like this:

# returns ['1', '2', '3']
"0123145" | grep("1", after=1e9, N=1) | deref()
__ror__(it: Iterator[str]) Iterator[str][source]
__invert__()[source]

Flips the pattern, just like how filt works. Example:

# returns ['a', 'b', 'c', 'e', '1', '2', '3', '4']
"abcde12d34" | ~grep("d") | deref()
class k1lib.cli.grep.grepTemplate(pattern: str, template: str)[source]

Bases: BaseCli

__init__(pattern: str, template: str)[source]

Searches over all lines, pick out the match, and expands it to the templateand yields

__ror__(it: Iterator[str])[source]

init module

class k1lib.cli.init.BaseCli(fs: list = [])[source]

Bases: object

A base class for all the cli stuff. You can definitely create new cli tools that have the same feel without extending from this class, but advanced stream operations (like +, &, .all(), |) won’t work.

At the moment, you don’t have to call super().__init__() and super().__ror__(), as __init__’s only job right now is to solidify any op passed to it, and __ror__ does nothing.

__init__(fs: list = [])[source]

Not expected to be instantiated by the end user.

fs param

Expected to use it like this:

class A(BaseCli):
    def __init__(self, f):
        fs = [f]; super().__init__(fs); self.f = fs[0]

Where f is some (potentially exotic) function. This will replace f with a “normal” function that’s executable. See source code of filt for an example of why this is useful. Currently, it will:

  • Replace with last recorded 4 in op(), if f is True, because Python does not allow returning complex objects from __contains__ method

  • Solidifies every op.

hint(_hint: tBase)[source]

Specifies output type hint.

property hasHint
__and__(cli: BaseCli) oneToMany[source]

Duplicates input stream to multiple joined clis. Example:

# returns [[5], [0, 1, 2, 3, 4]]
range(5) | (shape() & iden()) | deref()

Kinda like apply. There’re just multiple ways of doing this. This I think, is more intuitive, and apply is more for lambdas and columns mode. Performances are pretty much identical.

__add__(cli: BaseCli) mtmS[source]

Parallel pass multiple streams to multiple clis. Example:

# returns [8, 15]
[2, 3] | ((op() * 4) + (op() * 5)) | deref()
all(n: int = 1) BaseCli[source]

Applies this cli to all incoming streams. Example:

# returns (3,)
torch.randn(3, 4) | toMean().all() | shape()
# returns (3, 4)
torch.randn(3, 4, 5) | toMean().all(2) | shape()
Parameters

n – how many times should I chain .all()?

__or__(cli) serial[source]

Joins clis end-to-end. Example:

c = apply(op() ** 2) | deref()
# returns [0, 1, 4, 9, 16]
range(5) | c
__ror__(it)[source]
f() Table[Table[int]][source]

Creates a normal function \(f(x)\) which is equivalent to x | self.

__lt__(it)[source]

Backup pipe symbol >, purely for style, so that you can do something like this:

range(4) > file("a.txt")
__call__(it, *args)[source]

Another way to do it | cli. If multiple arguments are fed, then the argument list is passed to cli instead of just the first element. Example:

@applyS
def f(it):
    return it
f(2) # returns 2
f(2, 3) # returns [2, 3]
k1lib.cli.init.yieldT

Object often used as a sentinel, or an identifying token in lots of clis, including that can be yielded in a stream to ignore this stream for the moment in joinStreamsRandom, deref, tCheck and tOpt

k1lib.cli.init.fastF(c, x=None)[source]

Tries to figure out what’s going on, is it a normal function, or an applyS, or a BaseCli, etc., and return a really fast function for execution. Example:

# both returns 16, fastF returns "lambda x: x**2", so it's really fast
fastF(op()**2)(4)
fastF(applyS(lambda x: x**2))(4)

At the moment, parameter x does nothing, but potentially in the future, you can pass in an example input to the cli, so that this returns an optimized, C compiled version.

Parameters

x – sample data for the cli

class k1lib.cli.init.serial(*clis: List[BaseCli])[source]

Bases: BaseCli

__init__(*clis: List[BaseCli])[source]

Merges clis into 1, feeding end to end. Used in chaining clis together without a prime iterator. Meaning, without this, stuff like this fails to run:

[1, 2] | a() | b() # runs
c = a() | b(); [1, 2] | c # doesn't run if this class doesn't exist
__ror__(it: Iterator[Any]) Iterator[Any][source]
class k1lib.cli.init.oneToMany(*clis: List[BaseCli])[source]

Bases: BaseCli

__init__(*clis: List[BaseCli])[source]

Duplicates 1 stream into multiple streams, each for a cli in the list. Used in the “a & b” joining operator. See also: BaseCli.__and__()

__ror__(it: Iterator[Any]) Iterator[Iterator[Any]][source]
class k1lib.cli.init.mtmS(*clis: List[BaseCli])[source]

Bases: BaseCli

__init__(*clis: List[BaseCli])[source]

Applies multiple streams to multiple clis independently. Used in the “a + b” joining operator. See also: BaseCli.__add__().

Weird name is actually a shorthand for “many to many specific”.

__ror__(its: Iterator[Any]) Iterator[Any][source]
static f(f, i: int, n: int = 100)[source]

Convenience method, so that this:

mtmS(iden(), op()**2, iden(), iden(), iden())
# also the same as this btw:
(iden() + op()**2 + iden() + iden() + iden())

is the same as this:

mtmS.f(op()**2, 1, 5)

Example:

# returns [5, 36, 7, 8, 9]
range(5, 10) | mtmS.f(op()**2, 1, 5) | deref()
Parameters
  • i – where should I put the function?

  • n – how many clis in total? Defaulted to 100

k1lib.cli.init.patchDict()[source]

Patches dictionaries’s items and keys, so that piping works:

d = {"a": 3, "b": 4}
d.keys() | deref() # returns ["a", "b"]
d.items() | deref() # returns [["a", 3], ["b", 4]]
k1lib.cli.init.patchNumpy()[source]

Patches numpy arrays and data types, so that piping like this work:

a = np.random.randn(3)
a | shape() # returns (3,)
k1lib.cli.init.patchPandas()[source]

Patches panda’s pandas.core.series.Series and pandas.core.frame.DataFrame so that piping works:

pd.read_csv("a.csv")["col3"] | shape()

inp module

This module for tools that will likely start the processing stream.

cat.pickle(pickleModule=<module 'dill' from '/home/kelvin/anaconda3/envs/torch/lib/python3.9/site-packages/dill/__init__.py'>)

Reads a file as a series of pickled objects. Example:

"ab" | aS(dill.dumps) | file("test/catTest.pth")
"cd" | aS(dill.dumps) >> file("test/catTest.pth") # append to the file
# returns ["ab", "cd"]
cat.pickle("test/catTest.pth") | deref()
# also returns ["ab", "cd"], same style as :class:`cat`
"test/catTest.pth" | cat.pickle() | deref()
Parameters
  • fileName – name of the pickled file

  • pickleModule – pickle module to use. Python’s default is “pickle”, but I usually use dill because it’s more robust

k1lib.cli.inp.cat(fileName: Optional[str] = None, text: bool = True, chunks: Optional[bool] = None, profile: bool = False, sB=0, eB=-1)[source]

Reads a file line by line. Example:

# display first 10 lines of file
cat("file.txt") | headOut()
# piping in also works
"file.txt" | cat() | headOut()

# read bytes from an image file and dumps it to another file
cat("img.png", False) | file("img2.png")

If you want to read only specific sections of the file, you can specify the start (sB) and end byte (eB) like this:

"123456\n89" | file("test/catTest.pth")
# returns ['3456', '8']
cat("test/catTest.pth", sB=2, eB=8) | deref()

settings.cat.context.chunkSize=3 # just for demonstration, don't do it normally
# returns [b'123', b'456', b'\n8']
cat("test/catTest.pth", text=False, chunks=True, eB=8) | deref()

If you are working with large files and would like to read 1 file from multiple threads/processes, then you can use this cli in conjunction with splitSeek.

If you are dumping multiple pickled objects into a single file, you can read all of them using cat.pickle().

This cli has lots of settings at settings.cli.cat

Parameters
  • fileName – if None, then return a BaseCli that accepts a file name and outputs Iterator[str]

  • text – if True, read text file, else read binary file

  • chunks – if True then reads the file chunk by chunk, else reads the entire file. Defaults to True in text mode and False in binary mode

  • profile – whether to profile the file reading rate or not. Can adjust printing frequency using settings.cli.cat.every

  • sB – “start byte”. Specify this if you want to start reading from this byte

  • eB – “end byte”, exclusive. Default -1 means end of file

class k1lib.cli.inp.splitSeek(n=None, c=b'\n', ws=None)[source]

Bases: BaseCli

__init__(n=None, c=b'\n', ws=None)[source]

Splits a file up into n fragments aligned to the closest character and return the seek points. Example:

# preparing the large file
range(120) | apply(lambda x: f"{x:3}_56789") | file("test/largeFile.txt")
# returns [0, 30, 70, 110, 150, 190, 230, 270, 300, 340]
"test/largeFile.txt" | splitSeek(31) | head()
# returns 32
"test/largeFile.txt" | splitSeek(31) | shape(0)
# returns 32, demonstrating you can also pipe file objects in, if that's what you want
open("test/largeFile.txt") | splitSeek(31) | shape(0)
# returns [0, 0, 10, 10, 20, 30, 30, 40, 40, 50], notice some segments have zero length
"test/largeFile.txt" | splitSeek(200) | head()
# returns [0, 400, 1200], demonstrating that you can split a file up unevenly by weights
"test/largeFile.txt" | splitSeek(ws=[1, 2]) | deref()

So, the generated file has 120 lines in total. Each line is 10 bytes (9 for the string, and 1 for the new line character). Splitting the file into 31 fragments will result in 32 seek points (\(p_i\quad i\in[1, n+1]\)). You can then use these seek points to read the file in multiple threads/processes using cat(), like this:

# returns [['  0_56789', '  1_56789', '  2_56789'], ['  3_56789', '  4_56789', '  5_56789', '  6_56789']]
"test/largeFile.txt" | splitSeek(31) | splitSeek.window() | ~apply(lambda sB, eB: cat("test/largeFile.txt", sB=sB, eB=eB)) | head(2) | deref()

Because \(120/31\approx4\), most of cat’s reads contain 4 lines, but some has 3 lines. Also notice that the lines smoothly transitions between cat’s reads (2_56789 to 3_56789), so that’s pretty nice.

Warning

You have to really test whether reading the same file from multiple processes is going to be really faster or not. If your data is stored in a HDD (aka hard drive, with spinning disks), then it will actually slow you down (10x-100x), because the disk will have to context switch all the time, and each switch has a 10ms cost.

You also have to take into account collecting together the results of all processes, which can bottleneck the cpu. Read more about concurrency pitfalls at applyMp.

In some scenarios where you want to adjust the seek points even more, like when you want to parse FASTA genome files, which has blocks of 2/4 lines each like this:

@FP200005993L1C001R00100000061/2
TTTTAAACTTGCATTCTTTGGAGATTTGCTGAGTGTTGCTAGAGCTGGGAAACTTTTTTAATGAGATACGTGCATATTTTTCAAATTTACAGATCTTTTTTCACAAAAATAGAAAGTCATAAATGTGAAATGGAAACCTAAACAAGGCAA
+
GFEEEDEFGFFFFEFFFFFIFCEEEFFFGFFDFEGEDGFFFGDGFFGDGCE@GGGEEFDFGFGCFDFGGHCHFFFGFFFFFGEFDFFGHGFGEEHGFGEGFGFHFFEGFFFE;GEGEFGGHFFEI=GDAEDIFDDFGHFGEFGFEGGGGF
@FP200005993L1C001R00100000167/2
CTGGAATTTGGTATCTTATTGCCAAAGAATCTGTTTTGTGAAACTTGGGATCTCTATTTTAATGTTAATTCTGGTCAGTTGTGCCTAAACTCCATAAAGCAGGGACTATACTGAGGCGTATTCAATCTTCCTTCTTACCAAGGCCAGGAA
+
EEFECEDEFFCGFFFFFEEEGEGFEDECCEFEFDFEEFDFEDDFEFEEFDDFFEEFFEEFEFFHEEFEEFEFFDEFFFECF>FFFEFEDFCFFFEGFEDEEGDDFEEFEFGEEBD@EG>EEFFECEEGFEEEFFEDGEEEDE5EBDG:CC

Here, each 4 lines are (title, read, blank, quality). Because by default, this will only split neatly along new lines, you will have to write extra functions to detect if a particular seek point is desirable, and if not, either jump forward or backward using splitSeek.forward() and splitSeek.backward().

Parameters
  • n – how many splits do you want?

  • c – block-boundary character, usually just the new line character

  • ws – weights. If given, the splits length ratios will roughly correspond to this

static forward(f, i: int, c=b'\n') int[source]

Returns char location after the search char, going forward. Example:

f = io.BytesIO(b"123\n456\n789\nabc")
f | splitSeek(2) # returns [0, 4, 15]
splitSeek.forward(f, 2) # returns 4
splitSeek.forward(f, 3) # returns 4
splitSeek.forward(f, 4) # returns 8
Parameters
  • f – file handle

  • i – current seek point

  • c – block-boundary character

static backward(f, i: int, c=b'\n') int[source]

Returns char location after the search char, going backward. Example:

f = io.BytesIO(b"123\n456\n789\nabc")
f | splitSeek(2) # returns [0, 4, 15]
splitSeek.backward(f, 5) # returns 4
splitSeek.backward(f, 4) # returns 4
splitSeek.backward(f, 3) # returns 0
Parameters
  • f – file handle

  • i – current seek point

  • c – block-boundary character

__ror__(fn)[source]
static window()[source]

Converts input boundaries into segment windows. Example:

# returns [[0, 4], [5, 9], [10, 20]]
[0, 5, 10, 20] | splitSeek.window()
# example use case
"abc.txt" | splitSeek(10) | splitSeek.window()
class k1lib.cli.inp.refineSeek(f, window=1)[source]

Bases: BaseCli

__init__(f, window=1)[source]

Refines seek positions. Example:

# returns list of integers for seek positions
"abc.txt" | splitSeek(30)
# returns refined seek positions, such that the line starting at the seek positions starts with "@"
"abc.txt" | splitSeek(30) | refineSeek(lambda x: x.startswith(b"@"))
# same thing as above
"abc.txt" | splitSeek(30) | refineSeek(lambda x: x[0] == b"@"[0])
# returns refined seek positions, such that 0th line starts with "@" and 2nd line starts with "+". This demonstrates `window` parameter
"abc.txt" | splitSeek(30) | refineSeek(lambda x: x[0][0] == b"@"[0] and x[2][0] == b"+"[0], 3)
# same thing as above, demonstrating some builtin refine seek functions
"abc.txt" | splitSeek(30) | refineSeek.fastq()
Parameters
  • f – function that returns True if the current line/lines is a valid block boundary

  • window – by default (1), will fetch 1 line and check boundary using f(line). If a value greater than 1 is passed (for example, 3), will fetch 3 lines and check boundary using f([line1, line2, line3])

__ror__(seeks)[source]
classmethod fastq()[source]

Refine fastq file’s seek points

k1lib.cli.inp.curl(url: str, tries=3) Iterator[str][source]

Gets file from url. File can’t be a binary blob. Example:

# prints out first 10 lines of the website
curl("https://k1lib.github.io/") | headOut()
Parameters
  • url – the url to get the contents of

  • tries – how many times to retry the request

k1lib.cli.inp.wget(url: str, fileName: Optional[str] = None, mkdir=True)[source]

Downloads a file. Also returns the file name, in case you want to pipe it to something else.

Parameters
  • url – The url of the file

  • fileName – if None, then tries to infer it from the url

  • mkdir – whether to make the directory leading up to the file or not

k1lib.cli.inp.ls(folder: Optional[str] = None)[source]

List every file and folder inside the specified folder. Example:

# returns List[str]
ls("/home")
# same as above
"/home" | ls()
# only outputs files, not folders
ls("/home") | filt(os.path.isfile)
class k1lib.cli.inp.cmd(cmd: str, mode: int = 1, text=True, block=False)[source]

Bases: BaseCli

__init__(cmd: str, mode: int = 1, text=True, block=False)[source]

Runs a command, and returns the output line by line. Can pipe in some inputs. If no inputs then have to pipe in None. Example:

# return detailed list of files
None | cmd("ls -la")
# return list of files that ends with "ipynb"
None | cmd("ls -la") | cmd('grep ipynb$')

It might be tiresome to pipe in None all the time. So, you can use “>” operator to yield values right away:

# prints out first 10 lines of list of files
cmd("ls -la") > headOut()

If you’re using Jupyter notebook/lab, then if you were to display a cmd object, it will print out the outputs. So, a single command cmd("mkdir") displayed at the end of a cell is enough to trigger creating the directory.

Reminder that “>” operator in here sort of has a different meaning to that of BaseCli. So you kinda have to becareful about this:

# returns a serial cli, cmd not executed
cmd("ls -la") | deref()
# executes cmd with no input stream and pipes output to deref
cmd("ls -la") > deref()
# returns a serial cli
cmd("ls -la") > grep("txt") > headOut()
# executes pipeline
cmd("ls -la") > grep("txt") | headOut()

General advice is, right ater a cmd, use “>”, and use “|” everywhere else.

Let’s see a few more exotic examples. File a.sh:

#!/bin/bash

echo 1; sleep 0.5
echo This message goes to stderr >&2
echo 2; sleep 0.5
echo $(</dev/stdin)
sleep 0.5; echo 3

Examples:

# returns [b'1\n', b'2\n', b'45\n', b'3\n'] and prints out the error message
"45" | cmd("./a.sh", text=False) | deref()
# returns [b'This message goes to stderr\n']
"45" | cmd("./a.sh", mode=2, text=False) | deref()
# returns [[b'1\n', b'2\n', b'45\n', b'3\n'], [b'This message goes to stderr\n']]
"45" | cmd("./a.sh", mode=0, text=False) | deref()

Performance-wise, stdout and stderr will yield values right away as soon as the process outputs it, so you get real time feedback. However, this will convert the entire input into a bytes object, and not feed it bit by bit lazily, so if you have a humongous input, it might slow you down a little.

Also, because stdout and stderr yield values right away, it means that if you want the operation to be blocking until finished, you have to consume the output:

None | cmd("mkdir abc")
# might fail, because this might get executed before the previous line
None | cmd("echo a>abc/rg.txt")

None | cmd("mkdir abc") | ignore()
# will succeed, because this will be guaranteed to execute after the previous line
None | cmd("echo a>abc/rg.txt")

Settings: - cli.quiet: if True, won’t display errors in mode 1

Parameters
  • mode – if 0, returns (stdout, stderr). If 1, returns stdout and prints stderr if there are any errors. If 2, returns stderr

  • text – whether to decode the outputs into str or return raw bytes

  • block – whether to wait for the task to finish before returning to Python or not

__ror__(it: Union[None, str, bytes, Iterator[Any]]) Iterator[Union[str, bytes]][source]

Pipes in lines of input, or if there’s nothing to pass, then pass None

class k1lib.cli.inp.walk(**kwargs)[source]

Bases: BaseCli

__init__(**kwargs)[source]

Recursively get all files inside a dictionary. Example:

# prints out first 10 files
"." | walk() | headOut()
__ror__(path)[source]
k1lib.cli.inp.requireCli(cliTool: str)[source]

Searches for a particular cli tool (eg. “ls”), throws ImportError if not found, else do nothing

k1lib.cli.inp.urlPath(base: str, host: bool = True)[source]

Translates from a url to a file path. Example:

base = "~/ssd/some/other/path"
url = "http://example.com/some/path/to/file.txt"
url | urlPath(base) # returns "~/ssd/some/other/path/example_com/some/path/to/file.txt"
url | urlPath(base, False) # returns "~/ssd/some/other/path/some/path/to/file.txt"
Parameters

base – base directory you want the files to be in

kcsv module

All tools related to csv file format. Expected to use behind the “kcsv” module name, like this:

from k1lib.imports import *
kcsv.cat("file.csv") | display()
k1lib.cli.kcsv.cat(file: Optional[str] = None) Table[str][source]

Opens a csv file, and turns them into nice row elements

kxml module

All tools related to xml file format. Expected to use behind the “kxml” module name, like this:

from k1lib.imports import *
cat("abc.xml") | kxml.node() | kxml.display()
class k1lib.cli.kxml.node(fs: list = [])[source]

Bases: BaseCli

Turns lines into a single node. Example:

s = """
<html>
    <head>
        <style></style>
    </head>
    <body>
        <div></div>
    </body>
</html>"""
# returns root node
s | kxml.node()
# same thing as above, demonstrating you can pipe in list of strings
s.split("\n") | kxml.node()
__ror__(it: Iterator[str]) Element[source]
class k1lib.cli.kxml.maxDepth(depth: Optional[int] = None, copy: bool = True)[source]

Bases: BaseCli

__init__(depth: Optional[int] = None, copy: bool = True)[source]

Filters out too deep nodes. Example:

# returns root node, but prunes children deeper than the specified depth
s | kxml.node() | kxml.maxDepth()
Parameters
  • depth – max depth to include in

  • copy – whether to limit the nodes itself, or limit a copy

__ror__(node: Element) Element[source]
class k1lib.cli.kxml.tags(*tags: List[str], nested=False)[source]

Bases: BaseCli

__init__(*tags: List[str], nested=False)[source]

Finds all tags that have a particular name.. Example:

s = """
<EXPERIMENT_PACKAGE_SET>
  <EXPERIMENT_PACKAGE>
    <EXPERIMENT_PACKAGE/>
    <Pool/>
    <RUN_SET/>
  </EXPERIMENT_PACKAGE>
  <EXPERIMENT_PACKAGE>
    <Pool/>
    <RUN_SET/>
  </EXPERIMENT_PACKAGE>
</EXPERIMENT_PACKAGE_SET>"""

# returns a list of "Pool" tags (with 2 elements) that are 2 levels deep
s | kxml.node() | kxml.tags("Pool") | toList()
# returns list with 2 tags
s | kxml.node() | kxml.tags("EXPERIMENT_PACKAGE")
# returns list with 3 tags
s | kxml.node() | kxml.tags("EXPERIMENT_PACKAGE", nested=True)
Parameters

nested – whether to search for “div” tag inside of another “div” tag

__ror__(node: Element) Iterator[Element][source]
class k1lib.cli.kxml.pretty(indent: Optional[str] = None)[source]

Bases: BaseCli

__init__(indent: Optional[str] = None)[source]

Converts the element into a list of xml strings, and make them pretty. Example:

# prints out the element
s | kxml.node() | kxml.pretty() | stdout()
__ror__(it: Element) Iterator[str][source]
class k1lib.cli.kxml.display(depth: int = 3, lines: int = 20)[source]

Bases: BaseCli

__init__(depth: int = 3, lines: int = 20)[source]

Convenience method for getting head, make it pretty and print it out. Example:

# prints out the element
s | kxml.node() | kxml.display()
Parameters
  • depth – prune tags deeper than the specified depth. Put “None” to not prune at all

  • lines – max number of lines to print out. Put “None” if you want to display everything

__ror__(it: Element, lines=10)[source]

modifier module

This is for quick modifiers, think of them as changing formats

class k1lib.cli.modifier.applyS(f: Callable[[T], T], *args, **kwargs)[source]

Bases: BaseCli

__init__(f: Callable[[T], T], *args, **kwargs)[source]

Like apply, but much simpler, just operating on the entire input object, essentially. The “S” stands for “single”. There’s also an alias shorthand for this called aS. Example:

# returns 5
3 | aS(lambda x: x+2)

Like apply, you can also use this as a decorator like this:

@aS
def f(x):
    return x+2
# returns 5
3 | f

This also decorates the returned object so that it has same qualname, docstring and whatnot.

Shorthands

Writing out “lambda x:” all the time is annoying, and there are ways to quickly say lambda x: x+2 like so:

3 | op()+2 # returns 5
3 | aS("x+2") # returns 5. Behind the scenes, it compiles and execute `lambda x: x+2`

The first way is to use op, that will absorb all operations done on it, like “+”, and returns a function that essentially replays all the operations.

In the second way, you only have to pass in the string containing code that you want done on the variable “x”. Then internally, it will compile to regular Python code.

In fact, you can pass in op() or just a string to any cli that accepts any kind of function, like filt or apply:

range(4) | apply("x-2") | deref()
range(4) | apply(op()-2) | deref()
range(4) | filt("x%2") | deref()
range(4) | filt(op()%2) | deref()
Parameters
  • f – the function to be executed

  • kwargs – other keyword arguments to pass to the function, together with args

__ror__(it: T) T[source]
__invert__()[source]

Configures it so that it expand the arguments out. Example:

# returns 5
[2, 3] | ~aS(lambda x, y: x + y)

def f(x, y, a=4):
    return x*y + a
# returns 10
[2, 3] | ~aS(f)
# returns 11
[2, 3] | ~aS(f, a=5)
k1lib.cli.modifier.aS

alias of applyS

class k1lib.cli.modifier.apply(f: Callable[[T], T], column: Optional[Union[int, List[int]]] = None, cache: int = 0, **kwargs)[source]

Bases: BaseCli

__init__(f: Callable[[T], T], column: Optional[Union[int, List[int]]] = None, cache: int = 0, **kwargs)[source]

Applies a function f to every element in the incoming list/iterator. Example:

# returns [0, 1, 4, 9, 16]
range(5) | apply(lambda x: x**2) | deref()
# returns [[3.0, 1.0, 1.0], [3.0, 1.0, 1.0]], running the function on the 0th column
torch.ones(2, 3) | apply(lambda x: x+2, 0) | deref()
# returns [[0, -1, 2, 3, -4], [2, -3, 4, 5, -6], [0, -1, 4, 9, -16]], running the function on the 1st (0-index btw) and 4th columns
[[0, 1, 2, 3, 4], [2, 3, 4, 5, 6], [0, 1, 4, 9, 16]] | apply(lambda x: -x, [1, 4]) | deref()

You can also use this as a decorator, like this:

@apply
def f(x):
    return x**2
# returns [0, 1, 4, 9, 16]
range(5) | f | deref()

You can also add a cache, like this:

def calc(i): time.sleep(0.5); return i**2
# takes 2.5s
range(5) | repeatFrom(2) | apply(calc, cache=10) | deref()
# takes 5s
range(5) | repeatFrom(2) | apply(calc) | deref()

You can add custom keyword arguments into the function:

def f(x, y, z=3):
    return x + y + z
# returns [15, 17, 19, 21, 23]
[range(5), range(10, 15)] | transpose() | ~apply(f, z=5) | deref()

If “apply” is too hard to remember, this cli also has an alias map_ that kinda mimics Python’s map(). Also slight reminder that you can’t pass in extra positional args like in aS, just extra keyword arguments.

Parameters
  • column – if not None, then applies the function to that column or columns only

  • cache – if specified, then caches this much number of values

  • kwargs – extra keyword arguments to pass in the function

__ror__(it: Iterator[str])[source]
__invert__()[source]

Same mechanism as in applyS, it expands the arguments out. Just for convenience really. Example:

# returns [10, 12, 14, 16, 18]
[range(5), range(10, 15)] | transpose() | ~apply(lambda x, y: x+y) | deref()
k1lib.cli.modifier.map_

alias of apply

class k1lib.cli.modifier.applyMp(f: Callable[[T], T], prefetch: Optional[int] = None, timeout: float = 8, utilization: float = 0.8, bs: int = 1, newPoolEvery: int = 0, **kwargs)[source]

Bases: BaseCli

__init__(f: Callable[[T], T], prefetch: Optional[int] = None, timeout: float = 8, utilization: float = 0.8, bs: int = 1, newPoolEvery: int = 0, **kwargs)[source]

Like apply, but execute a function over the input iterator in multiple processes. Example:

# returns [3, 2]
["abc", "de"] | applyMp(len) | deref()
# returns [5, 6, 9]
range(3) | applyMp(lambda x, bias: x**2+bias, bias=5) | deref()

# returns [[1, 2, 3], [1, 2, 3]], demonstrating outside vars work
someList = [1, 2, 3]
["abc", "de"] | applyMp(lambda s: someList) | deref()

Internally, this will continuously spawn new jobs up until 80% of all CPU cores are utilized. On posix systems, the default multiprocessing start method is fork(). This sort of means that all the variables in memory will be copied over. On windows and macos, the default start method is spawn, meaning each child process is a completely new interpreter, so you have to pass in all required variables and reimport every dependencies. Read more at https://docs.python.org/3/library/multiprocessing.html#contexts-and-start-methods

If you don’t wish to schedule all jobs at once, you can specify a prefetch amount, and it will only schedule that much jobs ahead of time. Example:

range(10000) | applyMp(lambda x: x**2)    | head() | deref() # 700ms
range(10000) | applyMp(lambda x: x**2, 5) | head() | deref() # 300ms

# demonstrating there're no huge penalties even if we want all results at the same time
range(10000) | applyMp(lambda x: x**2)    | deref() # 900ms
range(10000) | applyMp(lambda x: x**2, 5) | deref() # 1000ms

The first line will schedule all jobs at once, and thus will require more RAM and compute power, even though we discard most of the results anyway (the head cli). The second line only schedules 5 jobs ahead of time, and thus will be extremely more efficient if you don’t need all results right away.

Note

Remember that every BaseCli is also a function, meaning that you can do stuff like:

# returns [['ab', 'ac']]
[["ab", "cd", "ac"]] | applyMp(filt(op().startswith("a")) | deref()) | deref()

Also remember that the return result of f should be serializable, meaning it should not be a generator. That’s why in the example above, there’s a deref() inside f. You should also convert PyTorch tensors into Numpy arrays

Most of the time, you would probably want to specify bs to something bigger than 1 (may be 32 or sth like that). This will executes f multiple times in a single job, instead of executing f only once per job. Should reduce overhead of process creation dramatically.

If you encounter strange errors not seen on apply, you can try to clear all pools (using clearPools()), to terminate all child processes and thus free resources. On earlier versions, you have to do this manually before exiting, but now applyMp is much more robust.

Also, you should not immediately assume that applyMp will always be faster than apply. Remember that applyMp will create new processes, serialize and transfer data to them, execute it, then transfer data back. If your code transfers a lot of data back and forth (compared to the amount of computation done), or the child processes don’t have a lot of stuff to do before returning, it may very well be a lot slower than apply.

There’s a potential loophole here that can make your code faster. Because the main process is forked (at least on linux), every variable is still there, even the big ones. So, you can potentially do something like this:

bigData = [] # 1B items in the list
# summing up all items together. No input data transfers (because it's forked instead)
range(1_000_000_000) | batched(100) | applyMp(lambda r: r | apply(lambda i: bigData[i]) | toSum()) | toSum()

In fact, I use this loophole all the time, and thus has made the function shared(), so check it out.

Parameters
  • prefetch – if not specified, schedules all jobs at the same time. If specified, schedules jobs so that there’ll only be a specified amount of jobs, and will only schedule more if results are actually being used.

  • timeout – seconds to wait for job before raising an error

  • utilization – how many percent cores are we running? 0 for no cores, 1 for all the cores. Defaulted to 0.8

  • bs – if specified, groups bs number of transforms into 1 job to be more efficient.

  • kwargs – extra arguments to be passed to the function. args not included as there’re a couple of options you can pass for this cli.

  • newPoolEvery – creates a new processing pool for every specific amount of input fed. 0 for not refreshing any pools at all. Turn this on in case your process consumes lots of memory and you have to kill them eventually to free up some memory

__ror__(it: Iterator[T]) Iterator[T][source]
static cat(fileName: str, f: Callable, n: Optional[int] = None, rS=None, **kwargs)[source]

Like applyCl.cat(), this will split a file up into multiple sections, execute f over all sections and return the results. Example:

fn = "~/repos/labs/k1lib/k1lib/cli/test/applyMp.cat"
"0123456789\n"*100 | file(fn)
# returns [6, 6, 6, 7, 6, 6, 6, 7, 6, 6, 6, 7, 6, 6, 6, 8]
applyMp.cat(fn, shape(0), 16) | deref()
Parameters
  • f – function to execute on an iterator of lines

  • n – how many chunks should it split the file into. Defaulted to the number of cpu cores available

  • rSrefineSeek instance, if you need more fine-grained control over section boundaries so as to not make everything corrupted

  • kwargs – extra keyword arguments for applyMp

static shared(f, **kwargs)[source]

Execution model where the input iterator is dereferenced and shared across all processes, bypassing serialization. Example:

a = range(1_000_000_000) | apply(lambda x: x*1.5 - 2000) | aS(list) # giant data structure
a | batched(50_000_000, True) | applyMp(toSum()) | toSum() # has to serialize and deserialize lists of numbers, which wastes lots of cpu cycles and memory
a | applyMp.shared(toSum()) | toSum() # giant data structure is forked, no serialization happens, no memory even gets copied, much faster

In the 2nd line, most of the time is spent on serializing the data and transferring it to other processes, while in the 3rd line, most of the time is spent on calculating the sum instead, as the giant data structure is forked, and Linux doesn’t copy it internally.

__invert__()[source]

Expands the arguments out, just like apply. Example:

# returns [20, 20, 18, 14, 8, 0, -10, -22, -36, -52]
[range(10), range(20, 30)] | transpose() | ~applyMp(lambda x, y: y-x**2) | deref()
static clearPools()[source]

Terminate all existing pools. Do this before restarting/quitting the script/notebook to make sure all resources (like GPU) are freed. Update: you probably won’t have to call this manually anymore since version 0.9, but if you run into problems, try doing this.

static pools()[source]

Get set of all pools. Meant for debugging purposes only.

k1lib.cli.modifier.parallel

alias of applyMp

class k1lib.cli.modifier.applyCl(f, prefetch=None, timeout=60, bs=1, rss: Union[dict, str] = {}, pre: bool = False, orPatch=True, num_cpus=1, **kwargs)[source]

Bases: BaseCli

__init__(f, prefetch=None, timeout=60, bs=1, rss: Union[dict, str] = {}, pre: bool = False, orPatch=True, num_cpus=1, **kwargs)[source]

Like apply, but execute a function over the input iterator in multiple processes on multiple nodes inside of a cluster (hence “cl”). So, just a more powerful version of applyMp, assuming you have a cluster to run it on. Example:

# returns [3, 2]
["abc", "de"] | applyCl(len) | deref()
# returns [5, 6, 9]
range(3) | applyCl(lambda x, bias: x**2+bias, bias=5) | deref()

# returns [[1, 2, 3], [1, 2, 3]], demonstrating outside vars work
someList = [1, 2, 3]
["abc", "de"] | applyCl(lambda s: someList) | deref()

Internally, this uses the library Ray (https://www.ray.io) to do the heavy lifting. So, applyCl can be thought of as a thin wrapper around that library, but still has the same consistent interface as apply and applyMp. From all of my tests so far, it seems that applyCl works quite well and is quite robust, so if you have access to a cluster, use it over applyMp.

The library will connect to a Ray cluster automatically when you import everything using from k1lib.imports import *. It will execute import ray; ray.init(), which is quite simple. If you have ray installed, but does not want this default behavior, you can do this:

import k1lib
k1lib.settings.startup.init_ray = False
from k1lib.imports import *

As with applyMp, there are pitfalls and weird quirks to multiprocessing, on 1 or multiple nodes, so check out the docs over there to be aware of them, as those translates well to here.

Advanced use case

Not really advanced, but just a bit difficult to understand/follow. Let’s say that you want to scan through the home directory of all nodes, grab all files, read them, and get the number of bytes they have. You can do something like this:

a = None | applyCl.aS(lambda: None | cmd("ls ~") | filt(os.path.isfile) | deref()) | deref()
b = a | ungroup(single=True, begin=True) | deref()
c = b | applyCl(cat(text=False) | shape(0), pre=True) | deref()
d = c | groupBy(0, True) | apply(item().all() | toSum(), 1) | deref()

Noted, this is relatively complex. Let’s see what A, B, C and D looks like:

# A
[['7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d', ['Miniconda3-latest-Linux-x86_64.sh', 'mintupgrade-2023-04-01T232950.log']],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', ['5a', 'abc.jpg', 'a.txt']]]
# B
[['7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d', 'Miniconda3-latest-Linux-x86_64.sh'],
 ['7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d', 'mintupgrade-2023-04-01T232950.log'],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', '5a'],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 'abc.jpg'],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 'a.txt']]
# C
[['7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d', 74403966],
 ['7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d', 1065252],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 2601],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 16341],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 10177]]
# D
[['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 92185432],
 ['7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d', 75469218]]

The steps we’re concerned with is A and C. In step A, we’re running 2 processes, 1 for each node, to get all the file names in the home directory. In step C, we’re running 5 processes total, 2 on the first node and 3 on the second node. For each process, it’s going to read as bytes and count up those bytes. Finally in step D, the results are grouped together and the sizes summed.

So yeah, it’s pretty nice that we did all of that in a relatively short amount of code. The data is distributed too (reading multiple files from multiple nodes), so we’re truly not bottlenecked by anything.

Parameters
  • prefetch – if not specified, schedules all jobs at the same time. If specified, schedules jobs so that there’ll only be a specified amount of jobs, and will only schedule more if results are actually being used.

  • timeout – seconds to wait for job before raising an error

  • bs – if specified, groups bs number of transforms into 1 job to be more efficient.

  • rss – resources required for the task. Can be {“custom_resource1”: 2} or “custom_resource1” as a shortcut

  • pre – “preserve”, same convention as applyCl.aS(). If True, then allow passing through node ids as the first column to shedule jobs on those specific nodes only

  • orPatch – whether to automatically patch __or__ function so that cli tools can work with numpy arrays on that remote worker

  • num_cpus – how many cpu does each task take?

  • kwargs – extra arguments to be passed to the function. args not included as there’re a couple of options you can pass for this cli.

__ror__(it)[source]
__invert__()[source]

Expands the arguments out, just like apply. Example:

# returns [20, 20, 18, 14, 8, 0, -10, -22, -36, -52]
[range(10), range(20, 30)] | transpose() | ~applyCl(lambda x, y: y-x**2) | deref()
static nodeIds(includeSelf=True) List[str][source]

Returns a list of all node ids in the current cluster. Example:

applyCl.nodeIds() # returns something like ['7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d', '1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068']

If you want to get nodes’ metadata, then just use ray’s builtin function ray.nodes()

Parameters

includeSelf – whether to include node id of the current process or not

static nodeId() str[source]

Returns current node id

static meta() object[source]

Grabs the metadata object for the current node

static cpu() int[source]

Grabs the number of cpus available on this node

static aS(f, timeout: float = 8)[source]

Executes function f once for all node ids that are piped in. Example:

# returns [['1051da...', ['Desktop', 'Downloads']], ['7bb387...', ['Pictures', 'Music']]]
applyCl.nodeIds() | applyCl.aS(lambda: None | cmd("ls ~") | deref()) | deref()
# also returns [['1051da...', ['Desktop', 'Downloads']], ['7bb387...', ['Pictures', 'Music']]]
None | applyCl.aS(lambda: None | cmd("ls ~") | deref()) | deref()

If you want to execute f for all nodes, you can pass in None instead.

As a reminder, this kinda follows the same logic as the popular cli aS, where f is executed once, hence the name “apply Single”. Here, the meaning of “single” is different. It just means execute once for each node ids.

Parameters
  • f – main function to execute in each node. Not supposed to accept any arguments

  • timeout – seconds to wait for job before raising an error

static cmd(s: str, timeout: float = 8, sudo=False)[source]

Convenience function to execute shell command on all nodes. Example:

applyCl.cmd("mkdir -p /some/folder")

It returns [[nodeid1, output1], [nodeid2, output2]]. If you need more flexibility, fall back to applyCl.aS()

Parameters
  • s – shell command to execute

  • sudo – if True, will execute the command with sudo privileges. Will ask for password and then cache it internally for 5 minutes

static replicateFile(fn: str, nodeIds=None)[source]

Replicates a specific file in the current node to all the other nodes. Example:

applyCl.replicate("~/cron.log")

Internally, this will read chunks of 100kB of the specified file and dump it incrementally to all other nodes, which has implications on performance. To increase or decrease it, check out cat. This also means you can replicate arbitrarily large files around as long as you have the disk space for it, while ram size doesn’t really matter

Parameters

fn – file name

static balanceFile(fn: str, nAs: Optional[List[str]] = None, nBs: Optional[List[str]] = None, rS=None)[source]

Splits a specified file in node nAs and dumps other parts to nodes nBs. Example:

applyCl.balanceFile("~/cron.log")

This will split the big files up into multiple segments (1 for each node). Then for each segment, it will read through it chunk by chunk into memory, and then deposits it into the respective nodes. Finally, it truncates the original files down to its segment boundary.

The main goal of this is so that you can analyze a single big (say 200GB) file quickly. If that file is on a single node, then it will take forever, even with applyMp. So splitting things up on multiple nodes will make analyzing it a lot faster.

There’s also the function balanceFolder(), which has the opposite problem of having lots of small (say 100MB) files. So it will try to move files around (keeping them intact in the meantime) to different nodes so that the folder size ratio is roughly proportional to the cpu count.

The exact split rule depends on the number of CPUs of each node. Best to see an example:

Command:         applyCl.balanceFile("~/cron.log")
Verbose command: applyCl.balanceFile("~/cron.log", ["1"], ["1", "2", "3", "4", "5"])
----------- Before -----------
Node:      1  2  3  4 5
Cpu:       8  12 16 8 8
Size (GB): 52 0  0  0 0
----------- After  -----------
Node:      1  2  3  4 5
Cpu:       8  12 16 8 8
Size (GB): 8  12 16 8 8

This also works if you have files on existing nodes already, and are upgrading the cluster:

Command:         applyCl.balanceFile("~/cron.log")
Verbose command: applyCl.balanceFile("~/cron.log", ["1", "5"], ["1", "2", "3", "4", "5"])
----------- Before -----------
Node:      1  2  3  4  5
Cpu:       8  12 16 8  8
Size (GB): 26 0  0  26 0
----------- After  -----------
Node:      1  2  3  4  5
Cpu:       8  12 16 8  8
Size (GB): 8  12 16 8  8

If you want to move files out of a node when decommissioning them, you can do something like this:

Command:         applyCl.decommission("~/cron.log", ["3", "4"])
Verbose command: applyCl.balanceFile("~/cron.log", ["1", "2", "3", "4", "5"], ["1", "2", "5"])
----------- Before -----------
Node:      1  2  3  4 5
Cpu:       8  12 16 8 8
Size (GB): 8  12 16 8 8
----------- After  -----------
Node:      1  2  3  4 5
Cpu:       8  12 16 8 8
Size (GB): 15 22 0  0 15

Remember that the node ids “1”, etc. is for illustrative purposes only. You should get real node ids from nodeIds().

Why is the file size proportional to the number of cores on each node? Well, if you have more cores, you should be able to process more, so as to make everything balanced, right?

Again, this means that you can split arbitrarily large files as long as you have the disk space for it, ram size is not a concern. How does this perform? Not the best in the world if you don’t have a lot of nodes. With sata 3 ssds, 750MB/s ethernet, I got transfer speeds of roughly 100MB/s. This should increase as you have more nodes based on the code structure, but I haven’t tested it yet. Can it be faster? Definitely. Am I willing to spend time optimizing it? No.

Parameters
  • fn – file name

  • nAs – node ids that currently stores the file. If not specified, try to detect what nodes the file exists in

  • nBs – node ids that will store the file after balancing everything out. If not specified, will take all available nodes

  • rSrefineSeek instance, if you need more fine-grained control over section boundaries so as to not make everything corrupted

decommission(fn, nAs: List[str], rS=None)[source]

Convenience function for balanceFile(). See docs over there.

static cat(fn: Optional[str] = None, f: Optional[Callable] = None, timeout: float = 60, keepNodeIds: bool = False, multiplier: int = 1, includeId: bool = False)[source]

Reads a file distributedly, does some operation on them, collects and returns all of the data together. Example:

fn = "~/repos/labs/k1lib/k1lib/cli/test/applyCl.cat.data"
("0123456789"*5 + "\n") * 1000 | file(fn)
applyCl.splitFile(fn)
applyCl.cat(fn, shape(0), keepNodeIds=True) | deref()

That returns something like this (for a 2-node cluster, with 2 (node A) and 4 (node B) cpus respectively):

[['7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d', 167],
 ['7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d', 167],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 166],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 167],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 166],
 ['1051dafd2b0dac13561c46fe052f561400592f0723df2cd746a41068', 167]]

Here, we’re creating an initial file with 1000 lines. Then we’ll split it up into 2 fragments: 334 lines and 667 lines and store them on the respective nodes. Then, on node A, we’ll split the file up into 2 parts, each with 167 lines. On node B, we’ll split the file up into 4 parts, each with around 166 lines. Then we’ll schedule 6 processes total, each dealing with 166 lines. After all of that, results are collected together and returned.

If you want to distinguish between different processes inside f, for example you want to write results into different files, you can do something like this:

dir_ = "~/repos/labs/k1lib/k1lib/cli/test"
fn = f"{dir_}/applyCl.cat.data"
applyCl.cmd(f"rm -r {dir_}/applyCl")    # clear out old folders
applyCl.cmd(f"mkdir -p {dir_}/applyCl") # creating folders
# do processing on fn distributedly, then dump results into multiple files
applyCl.cat(fn, ~aS(lambda idx, lines: lines | shape(0) | aS(dill.dumps) | file(f"{dir_}/applyCl/{idx}.pth")), includeId=True) | deref()
# reading all files and summing them together
None | applyCl.aS(lambda: ls(f"{dir_}/applyCl")) | ungroup(single=True, begin=True) | applyCl(cat(text=False) | aS(dill.loads), pre=True) | cut(1) | toSum()

Simple mode

There’s also another mode that’s activated whenever f is not specified that feels more like vanilla cat. Say you have a file on a specific node:

nodeId = "7bb387b2920694abe9f7d2a2ed939b6d31843faf91d174d0221e871d"
fn = "~/ssd2/randomFile.txt"

# -------------- file is on current node --------------
cat(fn) # returns iterator of lines inside the file
fn | cat() # same thing as above
# -------------- file is on remote node --------------
[nodeId, fn] | applyCl.cat() # returns iterator of lines of the file
applyCl.cat([nodeId, fn]) # same thing
nodeId | applyCl.cat(fn) # also same thing

So yeah, there’re lots of ways to just simply read a file on a remote node. Is it too much? Probably, but good thing is that you can pick any that’s intuitive for you. Note that this mode is just for convenience only, for when you want to do exploratory analysis on a single remote file. To be efficient at bulk processing, use the normal mode instead.

Parameters
  • fn – file name

  • f – function to execute in every process

  • timeout – kills the processes if it takes longer than this amount of seconds

  • keepNodeIds – whether to keep the node id column or not

  • multiplier – by default, each node will spawn as many process as there are cpus. Sometimes you want to spawn more process, change this to a higher number

  • includeId – includes a unique id for this process

static balanceFolder(folder: str, maxSteps: Optional[int] = None, audit: bool = False)[source]

Balances all files within a folder across all nodes. Example:

base = "~/repos/labs/k1lib/k1lib/cli/test/applyCl.balance"
# deletes old structures and making test folder    
applyCl.cmd(f"rm -r {base}"); applyCl.cmd(f"mkdir -p {base}")
# creates 20 files of different sizes and dump it in the base folder of the current node
torch.linspace(1e4, 1e5, 20).int() | apply(lambda x: "x"*x) | insertIdColumn() | ~apply(lambda idx, contents: contents | file(f"{base}/{idx}.txt")) | deref();
# transfers files between nodes such that the total folder size is proportional to the number of cpus across nodes
applyCl.balanceFolder(base)
# get folder size of all nodes
None | applyCl.aS(lambda: ls(base) | apply(os.path.getsize) | toSum()) | deref()

# creates 20 additional files and dump it to the current node
torch.linspace(1e4, 1e5, 20).int() | apply(lambda x: "x"*x) | insertIdColumn() | ~apply(lambda idx, contents: contents | file(f"{base}/{idx+20}.txt")) | deref();
# balances the tree out again
applyCl.balance(base)
# get folder size of all nodes
None | applyCl.aS(lambda: ls(base) | apply(os.path.getsize) | toSum()) | deref()

So imagine that you just downloaded 1000 files to a single node on a specific folder, but you need to analyze all of them in a distributed manner. What you can do is to move some files to other nodes and then do your analysis. If you want to download more files, just dump it to any node (or download distributed across all nodes), then rebalance the folders and do your analysis.

Parameters
  • folder – folder to rebalance all of the files

  • maxSteps – what’s the maximum number of file transfers? By default has no limit, so that files are transferred until

  • audit – if True, don’t actually move files around and just return what files are going to be moved where

download(folder: str, merge: bool = False, timeout=120, chunkTimeout=5)[source]

Downloads a file distributedly to a specified folder. Example:

url = "https://vim.kelvinho.org"
fn = "~/repos/labs/k1lib/k1lib/cli/test/applyCl.download" # file/folder name
applyCl.download(url, fn)       # will download distributedly and dump file fragments into the folder fn
applyCl.download(url, fn, True) # same as above, but collects all fragments together, places it in fn in the current node, then deletes the temporary file fragments

This only works if the server allows partial downloads btw.

Parameters
  • url – url to download

  • folder – which folder to download parts into

  • merge – whether to merge all of the fragments together into a single file in the current node or not

  • timeout – timeout for each process

  • chunkTimeout – timeout for each file chunk inside each process

static diskScan(folder: str, raw=False)[source]

Scans for files and folders in the specified folder for potential distributed files and folders. A distributed file is a file that exists on more than 1 node. A distributed folder is a folder that that exists on more than 1 node and does not have any shared children. Example:

applyCl.diskScan("~/ssd2")
applyCl.diskScan("~/ssd2", True)

The first line does not return anything, but will print out something like this:

------------------------------------------------------------ Distributed folders ------------------------------------------------------------
Path                                                                                 Total size   Size on each node (node id and thread count)
                                                                                                  ae5f4, 8 thr   244f4, 16 thr   f776e, 8 thr
----------------------------------------                                             ----------   ------------   ------------    ------------
/home/kelvin/ssd2/data/genome/RegulationFeatureActivity                              16.19 GB     4.11 GB        7.91 GB         4.16 GB
/home/kelvin/ssd2/data/genome/go/release_geneontology_org                            8.35 GB      2.07 GB        4.17 GB         2.11 GB
/home/kelvin/ssd2/data/genome/RegulationFeatureActivity.backup                       1.72 GB      568.88 MB      552.89 MB       600.61 MB
/home/kelvin/ssd2/data/genome/00-common_all.idx                                      1.01 GB      341.74 MB      671.14 MB       0.0 B
/home/kelvin/ssd2/data/genome/genbank/ch1.dat.gz                                     50.71 MB     25.36 MB       0.0 B           25.36 MB
/home/kelvin/ssd2/test                                                               546.03 kB    136.15 kB      273.53 kB       136.35 kB
/home/kelvin/ssd2/data/genome/genbank/ch1                                            0.0 B        0.0 B          0.0 B           0.0 B

A distributed folder is a folder that has many files and folders inside, but their names
are all different from each other. It's managed by applyCl.balanceFolder()

------------------------------------------------------------ Replicated files ------------------------------------------------------------
Path                                                                                 Total size   Size on each node (node id and thread count)
                                                                                                  ae5f4, 8 thr   244f4, 16 thr   f776e, 8 thr
----------------------------------------                                             ----------   ------------   ------------    ------------
/home/kelvin/ssd2/data/genome/dummy.txt                                              3.3 kB       1.1 kB         1.1 kB          1.1 kB

A replicated file is a file that has been copied to multiple nodes. Size of all file
copies should be the same. It's managed by applyCl.replicateFile()

------------------------------------------------------------ Distributed files ------------------------------------------------------------
Path                                                                                 Total size   Size on each node (node id and thread count)
                                                                                                  ae5f4, 8 thr   244f4, 16 thr   f776e, 8 thr
----------------------------------------                                             ----------   ------------   ------------    ------------
/home/kelvin/ssd2/data/genome/00-All.vcf                                             130.95 GB    32.74 GB       65.48 GB        32.74 GB
/home/kelvin/ssd2/data/genome/MotifFeatures/homo_sapiens.GRCh38.motif_features.gff   55.86 GB     13.96 GB       27.93 GB        13.96 GB
/home/kelvin/ssd2/data/genome/00-common_all.vcf                                      9.42 GB      2.35 GB        4.71 GB         2.35 GB

A distributed file is a file that has been split into multiple pieces and sent to other
nodes. It's managed by applyCl.balanceFile()

While the second line will return a parseable data structure instead:

[[['/home/kelvin/ssd2/data/genome/RegulationFeatureActivity', [4113489746, 7912834090, 4164314316]],
  ['/home/kelvin/ssd2/data/genome/go/release_geneontology_org', [2071645117, 4172737915, 2107005131]],
  ['/home/kelvin/ssd2/data/genome/RegulationFeatureActivity.backup', [568878496, 552888466, 600610083]],
  ['/home/kelvin/ssd2/data/genome/00-common_all.idx', [341738564, 671136833, 0]],
  ['/home/kelvin/ssd2/data/genome/genbank/ch1.dat.gz', [25356744, 0, 25356764]],
  ['/home/kelvin/ssd2/test', [136152, 273530, 136351]],
  ['/home/kelvin/ssd2/data/genome/genbank/ch1', [0, 0, 0]]],
 [['/home/kelvin/ssd2/data/genome/dummy.txt', [1101, 1101, 1101]]],
 [['/home/kelvin/ssd2/data/genome/00-All.vcf', [32737509360, 65475018903, 32737509588]],
  ['/home/kelvin/ssd2/data/genome/MotifFeatures/homo_sapiens.GRCh38.motif_features.gff', [13963854962, 27927709895, 13963854962]],
  ['/home/kelvin/ssd2/data/genome/00-common_all.vcf', [2353901811, 4707803470, 2353901831]]]]

Remember that since an operating system usually have lots of shared files (like “~/.bashrc”, for example), these might be mistaken as a distributed file. Make sure to only scan folders that you store data in, or else it’ll take a long time to return.

Parameters
  • folder – the folder to scan through

  • raw – whether to return raw data or display it out nicely

class k1lib.cli.modifier.applyTh(f, prefetch: Optional[int] = None, timeout: float = 5, bs: int = 1, **kwargs)[source]

Bases: BaseCli

__init__(f, prefetch: Optional[int] = None, timeout: float = 5, bs: int = 1, **kwargs)[source]

Kinda like the same as applyMp, but executes f on multiple threads, instead of on multiple processes. Advantages:

  • Relatively low overhead for thread creation

  • Fast, if f is io-bound

  • Does not have to serialize and deserialize the result, meaning iterators can be exchanged

Disadvantages:

  • Still has thread creation overhead, so it’s still recommended to specify bs

  • Is slow if f has to obtain the GIL to be able to do anything

All examples from applyMp should work perfectly here.

__ror__(it)[source]
__invert__()[source]
class k1lib.cli.modifier.applySerial(f, *args, **kwargs)[source]

Bases: BaseCli

__init__(f, *args, **kwargs)[source]

Applies a function repeatedly. First yields input iterator x. Then yields f(x), then f(f(x)), then f(f(f(x))) and so on. Example:

# returns [2, 4, 8, 16, 32]
2 | applySerial(op()*2) | head(5) | deref()

If the result of your operation is an iterator, you might want to deref it, like this:

rs = iter(range(8)) | applySerial(rows()[::2])
# returns [0, 2, 4, 6]
rs | rows(1) | item() | deref()
# returns []. This is because all the elements are taken by the previous deref()
rs | item() | deref()
# returns [[2, 8], [10, -6], [4, 16], [20, -12]]
[2, 8] | ~applySerial(lambda a, b: (a + b, a - b)) | head(4) | deref()

rs = iter(range(8)) | applySerial(rows()[::2] | deref())
# returns [0, 2, 4, 6]
rs | rows(1) | item()
# returns [0, 4]
rs | item() # or `next(rs)`
# returns [0]
rs | item() # or `next(rs)`
Parameters

f – function to apply repeatedly

__ror__(it)[source]
__invert__()[source]
class k1lib.cli.modifier.sort(column: int = 0, numeric=True, reverse=False)[source]

Bases: BaseCli

__init__(column: int = 0, numeric=True, reverse=False)[source]

Sorts all lines based on a specific column. Example:

# returns [[5, 'a'], [1, 'b']]
[[1, "b"], [5, "a"]] | ~sort(0) | deref()
# returns [[2, 3]]
[[1, "b"], [5, "a"], [2, 3]] | ~sort(1) | deref()
# errors out, as you can't really compare str with int
[[1, "b"], [2, 3], [5, "a"]] | sort(1, False) | deref()
# returns [-1, 2, 3, 5, 8]
[2, 5, 3, -1, 8] | sort(None) | deref()
Parameters
  • column – if None, sort rows based on themselves and not an element

  • numeric – whether to convert column to float

  • reverse – False for smaller to bigger, True for bigger to smaller. Use __invert__() to quickly reverse the order instead of using this param

__ror__(it: Iterator[str])[source]
__invert__()[source]

Creates a clone that has the opposite sort order

class k1lib.cli.modifier.sortF(f: Callable[[T], float], column: Optional[int] = None, reverse=False)[source]

Bases: BaseCli

__init__(f: Callable[[T], float], column: Optional[int] = None, reverse=False)[source]

Sorts rows using a function. Example:

# returns ['a', 'aa', 'aaa', 'aaaa', 'aaaaa']
["a", "aaa", "aaaaa", "aa", "aaaa"] | sortF(lambda r: len(r)) | deref()
# returns ['aaaaa', 'aaaa', 'aaa', 'aa', 'a']
["a", "aaa", "aaaaa", "aa", "aaaa"] | ~sortF(lambda r: len(r)) | deref()
__ror__(it: Iterator[T]) Iterator[T][source]
__invert__() sortF[source]
class k1lib.cli.modifier.consume(f: Union[BaseCli, Callable[[T], None]])[source]

Bases: BaseCli

__init__(f: Union[BaseCli, Callable[[T], None]])[source]

Consumes the iterator in a side stream. Returns the iterator. Kinda like the bash command tee. Example:

# prints "0\n1\n2" and returns [0, 1, 2]
range(3) | consume(headOut()) | toList()
# prints "range(0, 3)" and returns [0, 1, 2]
range(3) | consume(lambda it: print(it)) | toList()

This is useful whenever you want to mutate something, but don’t want to include the function result into the main stream.

See also: tee

__ror__(it: T) T[source]
class k1lib.cli.modifier.randomize(bs=100, seed=None)[source]

Bases: BaseCli

__init__(bs=100, seed=None)[source]

Randomize input stream. In order to be efficient, this does not convert the input iterator to a giant list and yield random values from that. Instead, this fetches bs items at a time, randomizes them, returns and fetch another bs items. If you want to do the giant list, then just pass in float("inf"), or None. Example:

# returns [0, 1, 2, 3, 4], effectively no randomize at all
range(5) | randomize(1) | deref()
# returns something like this: [1, 0, 2, 3, 5, 4, 6, 8, 7, 9]. You can clearly see the batches
range(10) | randomize(3) | deref()
# returns something like this: [7, 0, 5, 2, 4, 9, 6, 3, 1, 8]
range(10) | randomize(float("inf")) | deref()
# same as above
range(10) | randomize(None) | deref()
# returns True, as the seed is the same
range(10) | randomize(seed=4) | deref() == range(10) | randomize(seed=4) | deref()
__ror__(it: Iterator[T]) Iterator[T][source]
class k1lib.cli.modifier.stagger(every: int)[source]

Bases: BaseCli

__init__(every: int)[source]

Staggers input stream into multiple stream “windows” placed serially. Best explained with an example:

o = range(10) | stagger(3)
o | deref() # returns [0, 1, 2], 1st "window"
o | deref() # returns [3, 4, 5], 2nd "window"
o | deref() # returns [6, 7, 8]
o | deref() # returns [9]
o | deref() # returns []

This might be useful when you’re constructing a data loader:

dataset = [range(20), range(30, 50)] | transpose()
dl = dataset | batched(3) | (transpose() | toTensor()).all() | stagger(4)
for epoch in range(3):
    for xb, yb in dl: # looping over a window
        print(epoch)
        # then something like: model(xb)

The above code will print 6 lines. 4 of them is “0” (because we stagger every 4 batches), and xb’s shape’ will be (3,) (because we batched every 3 samples).

You should also keep in mind that this doesn’t really change the property of the stream itself. Essentially, treat these pairs of statement as being the same thing:

o = range(11, 100)

# both returns 11
o | stagger(20) | item()
o | item()

# both returns [11, 12, ..., 20]
o | head(10) | deref()
o | stagger(20) | head(10) | deref()

Lastly, multiple iterators might be getting values from the same stream window, meaning:

o = range(11, 100) | stagger(10)
it1 = iter(o); it2 = iter(o)
next(it1) # returns 11
next(it2) # returns 12

This may or may not be desirable. Also this should be obvious, but I want to mention this in case it’s not clear to you.

__ror__(it: Iterator[T]) StaggeredStream[source]
static tv(every: int, ratio: float = 0.8)[source]

Convenience method to quickly stagger train and valid datasets. Example:

# returns [[16], [4]]
[range(100)]*2 | stagger.tv(20) | shape().all() | deref()
class k1lib.cli.modifier.op[source]

Bases: Absorber, BaseCli

__init__()[source]

Absorbs operations done on it and applies it on the stream. Based on Absorber. Example:

# returns 16
4 | op()**2
# returns 16, equivalent to the above
4 | aS(lambda x: x**2)
# returns [0, 1, 4, 9, 16]
range(5) | apply(op()**2) | deref()
# returns [0, 1, 4, 9, 16], equivalent to the above
range(5) | apply(lambda x: x**2) | deref()

Main advantage is that you don’t have to waste keystrokes when you just want to do a simple operation. How it works underneath is a little magical, so just treat it as a blackbox. A more complex example:

t = torch.tensor([[1, 2, 3], [4, 5, 6.0]])
# returns [torch.tensor([[4., 5., 6., 7., 8., 9.]])]
[t] | (op() + 3).view(1, -1).all() | deref()

Basically, you can treat op() as the input tensor. Tbh, you can do the same thing with this:

[t] | applyS(lambda t: (t+3).view(-1, 1)).all() | deref()

But that’s kinda long and may not be obvious. This can be surprisingly resilient, as you can still combine with other cli tools as usual, for example:

# returns [2, 3], demonstrating "&" operator
torch.randn(2, 3) | (op().shape & iden()) | deref() | item()

a = torch.tensor([[1, 2, 3], [7, 8, 9]])
# returns torch.tensor([4, 5, 6]), demonstrating "+" operator for clis and not clis
(a | op() + 3 + iden() | item() == torch.tensor([4, 5, 6])).all()

# returns [[3], [3]], demonstrating .all() and "|" serial chaining
torch.randn(2, 3) | (op().shape.all() | deref())

# returns [[8, 18], [9, 19]], demonstrating you can treat `op()` as a regular function
[range(10), range(10, 20)] | transpose() | filt(op() > 7, 0) | deref()

# returns [3, 4, 5, 6, 7, 8, 9], demonstrating bounds comparison
range(100) | filt(3 <= op() < 10) | deref()

This can only deal with simple operations only. For complex operations, resort to the longer version aS(lambda x: ...) instead!

There are also operations that are difficult to achieve, like len(op()), as Python is expecting an integer output, so op() can’t exactly take over. Instead, you have to use aS, or do op().ab_len(). Get a list of all of these special operations in the source of Absorber.

Performance-wise, in most cases, there are no degradation, so don’t worry about it. Everything is pretty much on par with native lambdas:

n = 10_000_000
# takes 1.48s
for i in range(n): i**2
# takes 1.89s, 1.28x worse than for loop
range(n) | apply(lambda x: x**2) | ignore()
# takes 1.86s, 1.26x worse than for loop
range(n) | apply(op()**2) | ignore()
# takes 1.86s
range(n) | (op()**2).all() | ignore()

More complex operations still retains the same speeds, as there’s a JIT compiler embedded in:

# takes 2.15s
for i in range(n): (i**2-3)*0.1
# takes 2.53s, 1.18x worse than for loop
range(n) | apply(lambda x: (x**2-3)*0.1) | ignore()
# takes 2.46s, 1.14x worse than for loop
range(n) | apply((op()**2-3)*0.1) | ignore()

Reserved operations that are not absorbed are:

  • all

  • __ror__ (__or__ still works!)

  • ab_solidify

  • op_hint

static solidify(f)[source]

Static equivalent of a.ab_solidify(). Example:

f = op()**2
f = op.solidify(f)

If f is not an op, then just return it without doing anything to it

__ror__(it)[source]
op_hint(_hint)[source]

Specify output type hint

class k1lib.cli.modifier.integrate(dt=1)[source]

Bases: BaseCli

__init__(dt=1)[source]

Integrates the input. Example:

# returns [0, 1, 3, 6, 10, 15, 21, 28, 36, 45]
range(10) | integrate() | deref()
# returns [0, 2, 6, 12, 20, 30, 42, 56, 72, 90]
range(10) | integrate(2) | deref()
Parameters

dt – Optional small step

__ror__(it)[source]

_applyCl module

These are helper functions for applyCl and are not intended for the end user (aka you) to use. They’re just here so that you can read the source code if interested.

k1lib.cli._applyCl.getIr(base)[source]
k1lib.cli._applyCl.normalize(d)[source]
k1lib.cli._applyCl.statsCpu()[source]
k1lib.cli._applyCl.statsNodeId()[source]
k1lib.cli._applyCl.stats(ir)[source]
k1lib.cli._applyCl.scores(ir)[source]
k1lib.cli._applyCl.score(ir)[source]
k1lib.cli._applyCl.move(ir, nA: str, nB: str, idx: int)[source]
k1lib.cli._applyCl.optimize(ir)[source]
k1lib.cli._applyCl.traj(ir, maxSteps=20)[source]
k1lib.cli._applyCl.collapse(it)[source]
k1lib.cli._applyCl.traj2(ir, maxSteps=20)[source]
k1lib.cli._applyCl.moveFile(fileName: str, destNodeId: str, timeout=60)[source]

Moves file from the current node to the destination node. Usually executed on other nodes than the driver node

k1lib.cli._applyCl.moveFF(ff: str, destNodeId: str, timeout=60)[source]

Moves file or folder from the current node to the destination node

k1lib.cli._applyCl.balanceFolder(base, audit=False, maxSteps=20)[source]
k1lib.cli._applyCl.getSize(url)[source]
exception k1lib.cli._applyCl.NoPartialContent[source]

Bases: Exception

k1lib.cli._applyCl.getChunk(url: str, sB: int, eB: int, timeout: float) bytes[source]
k1lib.cli._applyCl.getChunks(url: str, sB: int, eB: int, chunkSize=None, chunkTimeout: float = 10) List[bytes][source]

Grabs bytes from sB to eB in chunks

k1lib.cli._applyCl.download(url: str, folder: str, merge: bool = False, timeout=120, chunkTimeout=5)[source]
k1lib.cli._applyCl.a_transfer(fn, nse, nodeB, rpF: callable = <k1lib.cli.utils.iden object>)[source]

Transfers a lot of blocks from a bunch of nodes to nodeB. Does not delete from those node though

nse = List[nodeAId, [sB, eB]]

Runs on driver process, blocks, so better use applyTh outside of this

Parameters

rpF – ray progress function

k1lib.cli._applyCl.decommission(fn: str, nodeAs: ~typing.List[str], nodeBs: ~typing.List[str], rS=<k1lib.cli.utils.iden object>)[source]

Spreads out a particular file in nodeAs to all nodeBs, to prepare to decomission nodeAs. The 2 sets should be mutually exclusive

Parameters

rS – instance of refineSeek

k1lib.cli._applyCl.spreadOut(fn: str, nAs: ~typing.List[str], nBs: ~typing.List[str], rS=<k1lib.cli.utils.iden object>)[source]

Spreads out a file from nodes A to B, where B fully contains A (no decomissioning). A and B should be mutually exclusive. Initial nodes are A, final nodes are A + B

k1lib.cli._applyCl.balanceFile(fn: str, nAs: ~typing.Optional[~typing.List[str]] = None, nBs: ~typing.Optional[~typing.List[str]] = None, rS=<k1lib.cli.utils.iden object>)[source]
k1lib.cli._applyCl.diskScan1(base: str) List[str][source]
k1lib.cli._applyCl.diskScan2(base: str) Tuple[List[str], List[str]][source]
k1lib.cli._applyCl.diskScan3(base: str)[source]
k1lib.cli._applyCl.diskScan4(base: str, sortSize=True)[source]
k1lib.cli._applyCl.diskScan5(base: str, sortSize=True)[source]

nb module

This is for everything related to ipython notebooks. Expected to use behind the “nb” module name, like this:

from k1lib.imports import *
nb.execute("file.ipynb")
k1lib.cli.nb.cells(fileName=None, outputs=False)[source]

Gets simplified notebook cells from file source, including fields cell_type and source only. Example:

nb.cells("file.ipynb")
class k1lib.cli.nb.pretty(magics: bool = False, whitelist: List[str] = [], blacklist: List[str] = [])[source]

Bases: BaseCli

__init__(magics: bool = False, whitelist: List[str] = [], blacklist: List[str] = [])[source]

Makes the cells prettier. Cell 1 in file.ipynb:

#notest, export
a = 3

Cell 2 in file.ipynb:

b = 6

Code:

# only cell 2 gets chosen
nb.cells("file.ipynb") | nb.pretty(blacklist=["notest"])
# only cell 1 gets chosen
nb.cells("file.ipynb") | nb.pretty(whitelist=["export"])
Parameters
  • magics – if False, then if detected magics (‘!’, ‘%%’ symbols), then remove that line in cell’s source

  • whitelist – every cell that doesn’t have any of these properties will be filtered out

  • blacklist – every cell that has any of these properties will be filtered out

__ror__(cells)[source]
class k1lib.cli.nb.execute(fileName=None, _globals: Optional[dict] = None)[source]

Bases: BaseCli

__init__(fileName=None, _globals: Optional[dict] = None)[source]

Executes cells. Example:

nb.cells("file.ipynb") | nb.execute("nb.ipynb")

Most of the time, you’d want to pass cells through pretty first, to make sure everything is nice and clean

Parameters
  • fileName – not actually used to read the file. If specified, then changes the current working directory to that of the file

  • _globals – optional dict of global variables

__ror__(cells)[source]
static rightAway(fileName: str, _globals: Optional[dict] = None, tag: Optional[str] = None)[source]

Convenience function to execute a notebook right away. Example:

fn = "some/file.ipynb"
nb.cells(fn) | nb.pretty(whitelist=[tag]) | nb.execute(nb, globals())
nb.execute.rightAway(fn, globals(), tag)

Last 2 lines are pretty much the same.

output module

For operations that feel like the termination of operations

class k1lib.cli.output.stdout[source]

Bases: BaseCli

__init__()[source]

Prints out all lines. If not iterable, then print out the input raw. Example:

# prints out "0\n1\n2"
range(3) | stdout()
# same as above, but (maybe?) more familiar
range(3) > stdout()

This is rarely used alone. It’s more common to use headOut() for list of items, and display() for tables.

__ror__(it: Iterator[str])[source]
class k1lib.cli.output.tee(f=<function <lambda>>, s=None, every=1)[source]

Bases: BaseCli

__init__(f=<function <lambda>>, s=None, every=1)[source]

Like the Linux tee command, this prints the elements to another specified stream, while yielding the elements. Example:

# prints "0\n1\n2\n3\n4\n" and returns [0, 1, 4, 9, 16]
range(5) | tee() | apply(op() ** 2) | deref()

See also: consume

Parameters
  • f – element transform function. Defaults to just adding a new line at the end

  • s – stream to write to. Defaults to sys.stdout

  • every – only prints out 1 line in every lines, to limit print rate

__ror__(it)[source]
cr()[source]

Tee, but replaces the previous line. “cr” stands for carriage return. Example:

# prints "4" and returns [0, 1, 4, 9, 16]. Does print all the numbers in the middle, but is overriden
range(5) | tee().cr() | apply(op() ** 2) | deref()
crt()[source]

Like tee.cr(), but includes an elapsed time text at the end. Example:

range(5) | tee().cr() | apply(op() ** 2) | deref()
class k1lib.cli.output.file(fileName: Optional[str] = None, flush: bool = False, mkdir: bool = False)[source]

Bases: BaseCli

__init__(fileName: Optional[str] = None, flush: bool = False, mkdir: bool = False)[source]

Opens a new file for writing. This will iterate through the iterator fed to it and put each element on a separate line. Example:

# writes "0\n1\n2\n" to file
range(3) | file("test/f.txt")
# same as above, but (maybe?) more familiar
range(3) > file("text/f.txt")
# returns ['0', '1', '2']
cat("folder/f.txt") | deref()

If the input is a string, then it will just put the string into the file and does not iterate through the string:

# writes "some text\n123" to file, default iterator mode like above
["some text", "123"] | file("test/f.txt")
# same as above, but this is a special case when it detects you're piping in a string
"some text\n123" | file("test/f.txt")

If the input is a bytes object or an iterator of bytes, then it will open the file in binary mode and dumps the bytes in:

# writes bytes to file
b'5643' | file("test/a.bin")
[b'56', b'43'] >> file("test/a.bin")
# returns ['56435643']
cat("test/a.bin") | deref()

If the input is a PIL.Image.Image object, then it will just save the image in the file:

# creates an random image and saves it to a file
torch.randn(100, 200) | toImg() | file("a.png")

Reminder that the image pixel range is expected to be from 0 to 255. You can create temporary files on the fly by not specifying a file name:

# creates temporary file
url = range(3) > file()
# returns ['0', '1', '2']
cat(url) | deref()

This can be especially useful when integrating with shell scripts that wants to read in a file:

seq1 = "CCAAACCCCCCCTCCCCCGCTTC"
seq2 = "CCAAACCCCCCCCTCCCCCCGCTTC"
# use "needle" program to locally align 2 sequences
None | cmd(f"needle {seq1 > file()} {seq2 > file()} -filter")

You can also append to file with the “>>” operator:

url = range(3) > file()
# appended to file
range(10, 13) >> file(url)
# returns ['0', '1', '2', '10', '11', '12']
cat(url) | deref()
Parameters
  • fileName – if not specified, create new temporary file and returns the url when pipes into it

  • flush – whether to flush to file immediately after every iteration

  • mkdir – whether to recursively make directories going to the file location or not

__ror__(it: Iterator[str]) None[source]
property name

File name of this file

class k1lib.cli.output.pretty(delim='')[source]

Bases: BaseCli

__init__(delim='')[source]

Pretty prints a table. Not really used directly. Example:

# These 2 statements are pretty much the same
[range(10), range(10)] | head(5) | pretty() > stdout()
[range(10), range(10)] | display()
__ror__(it: Table[Any]) Iterator[str][source]
k1lib.cli.output.display(lines: int = 10)[source]

Convenience method for displaying a table. Pretty much equivalent to head() | pretty() | stdout().

See also: pretty

k1lib.cli.output.headOut(lines: int = 10)[source]

Convenience method for head() | stdout()

class k1lib.cli.output.intercept(f=None, raiseError: bool = True)[source]

Bases: BaseCli

__init__(f=None, raiseError: bool = True)[source]

Intercept flow at a particular point, analyze the object piped in, and raises error to stop flow. Example:

3 | intercept()
Parameters
  • f – prints out the object transformed by this function

  • raiseError – whether to raise error when executed or not.

__ror__(s)[source]
class k1lib.cli.output.plotImgs(col=5, aspect=1, fac=2, axis=False, table=False, im=False)[source]

Bases: BaseCli

__init__(col=5, aspect=1, fac=2, axis=False, table=False, im=False)[source]

Plots a bunch of images at the same time in a table. Example:

# plots all images
[torch.randn(10, 20), torch.randn(20, 10)] | plotImgs()
# plots all images with titles
[[torch.randn(10, 20), "img 1"], [torch.randn(20, 10), "img 2"]] | plotImgs()

If you have multiple rows with different number of images, you can plot that with this too, just set table=True like this:

[[torch.randn(10, 20), torch.randn(20, 10)], [torch.randn(10, 20)]] | plotImgs(table=True)
Parameters
  • col – number of columns in the table. If explicitly None, it will turn into the number of images fed. Not available if table=True

  • aspect – aspect ratio of each images, or ratio between width and height

  • fac – figsize factor. The higher, the more resolution

  • axis – whether to display the axis or not

  • table – whether to plot using table mode

  • im – if True, returns an image

__ror__(imgs)[source]

sam module

This is for functions that are .sam or .bam related

k1lib.cli.sam.cat(bamFile: Optional[str] = None, header: bool = True)[source]

Get sam file outputs from bam file. Example:

sam.cat("file.bam") | display()
"file.bam" | sam.cat(header=False) | display()
Parameters

header – whether to include headers or not

class k1lib.cli.sam.header(long=True)[source]

Bases: BaseCli

__init__(long=True)[source]

Adds a header to the table. Example:

sam.cat("file.bam") | sam.header() | display()

You can change the header labels like this:

settings.cli.sam.header.long = ["Query template name", ...]
Parameters

long – whether to use a long descriptive header, or a short one

__ror__(it)[source]
class k1lib.cli.sam.flag(f=None)[source]

Bases: bindec

__init__(f=None)[source]

Decodes flags attribute. Example:

# returns ['PAIRED', 'UNMAP']
5 | flag()
# returns 'PAIRED, UNMAP'
5 | flag(cli.join(", "))

You’ll mostly use this in this format:

sam.cat("file.bam", False) | apply(sam.flag(), 1) | display()

You can change the flag labels like this:

settings.cli.sam.flags = ["paired", ...]
Parameters

f – transform function fed into bindec, defaulted to join(”, “)

structural module

This is for functions that sort of changes the table structure in a dramatic way. They’re the core transformations

class k1lib.cli.structural.joinStreamsRandom(alpha=0, ps=None)[source]
__init__(alpha=0, ps=None)[source]

Join multiple streams randomly. If any streams runs out, then quits. If any stream yields yieldT, then just ignores that result and continue. Could be useful in active learning. Example:

# could return [0, 1, 10, 2, 11, 12, 13, ...], with max length 20, typical length 18
[range(0, 10), range(10, 20)] | joinStreamsRandom() | deref()

stream2 = [[-5, yieldT, -4, -3], yieldT | repeat()] | joinStreams()
# could return [-5, -4, 0, -3, 1, 2, 3, 4, 5, 6], demonstrating yieldT
[range(7), stream2] | joinStreamsRandom() | deref()

By default, all streams are treated equally, and are yielded with equal probabilities. However, you can tweak these probabilities a little bit, to your liking. This is controlled by the parameter alpha:

../_images/probScale.png

If alpha is 0, then all probabilities will be the same. If alpha is 1, then all probabilities are proportional to the length of the input stream. The original intention was to vary alpha just from 0 to 1, but it can actually be of any number:

[range(0, 10), range(10, 100)] | joinStreamsRandom(0) | shape(0) # returns around 21, because it favors both streams equally
[range(0, 10), range(10, 100)] | joinStreamsRandom(1) | shape(0) # returns around 90, because it favors the second array 9x more
[range(0, 10), range(10, 100)] | joinStreamsRandom(100) | shape(0) # returns 90, because it highly favors the second array
[range(0, 10), range(10, 100)] | joinStreamsRandom(-100) | shape(0) # returns 10, because it highly favors the first array
Parameters
  • alpha – if not zero, does a weighted joining, instead of totally uniform probability

  • ps – if specified, use these probabilities, else try to determine from the lengths of the input streams

__ror__(streams: Iterator[Iterator[T]]) Iterator[T][source]
class k1lib.cli.structural.transpose(dim1: int = 0, dim2: int = 1, fill=None)[source]

Bases: BaseCli

__init__(dim1: int = 0, dim2: int = 1, fill=None)[source]

Join multiple columns and loop through all rows. Aka transpose. Example:

# returns [[1, 4], [2, 5], [3, 6]]
[[1, 2, 3], [4, 5, 6]] | transpose() | deref()
# returns [[1, 4], [2, 5], [3, 6], [0, 7]]
[[1, 2, 3], [4, 5, 6, 7]] | transpose(fill=0) | deref()

Multidimensional transpose works just like torch.transpose() too:

# returns (2, 7, 5, 3), but detected Tensor, so it will use builtin :meth:`torch.transpose`
torch.randn(2, 3, 5, 7) | transpose(3, 1) | shape()
# also returns (2, 7, 5, 3), but actually does every required computation. Can be slow if shape is huge
torch.randn(2, 3, 5, 7) | deref(igT=False) | transpose(3, 1) | shape()

Can also work with numpy arrays:

# returns (5, 3, 2)
np.random.randn(2, 3, 5) | transpose(0, 2) | op().shape

Be careful with infinite streams, as transposing stream of shape (inf, 5) will hang this operation! Either don’t do it, or temporarily limit all infinite streams like this:

with settings.cli.context(inf=21):
    # returns (3, 21)
    [2, 1, 3] | repeat() | transpose() | shape()

Also be careful with empty streams, as you might not get any results at all:

# returns [], as the last stream has no elements
[[1, 2], [3, 4], []] | transpose() | deref()
# returns [[1, 3, 0], [2, 4, 0]]
[[1, 2], [3, 4], []] | transpose(fill=0) | deref()
Parameters

fill – if not None, then will try to zip longest with this fill value

__ror__(it: Iterator[Iterator[T]]) Table[T][source]
static fill(fill='', dim1: int = 0, dim2: int = 1)[source]

Convenience method to fill in missing elements of a table. Example:

# returns [[1, 2, 3], [4, 5, 0]]
[[1, 2, 3], [4, 5]] | transpose.fill(0) | deref()
# also returns [[1, 2, 3], [4, 5, 0]], demonstrating how it works underneath
[[1, 2, 3], [4, 5]] | transpose(fill=0) | transpose(fill=0) | deref()
static wrap(f, dim1: int = 0, dim2: int = 1, fill=None)[source]

Wraps f around 2 transpose, can be useful in combination with k1lib.cli.init.mtmS. Example:

# returns [[1, 4, 3, 4], [8, 81, 10, 11]]
[range(1, 5), range(8, 12)] | transpose.wrap(mtmS.f(apply(op()**2), 1)) | deref()
# also returns [[1, 4, 3, 4], [8, 81, 10, 11]], demonstrating the typical way to do this
[range(1, 5), range(8, 12)] | apply(op()**2, 1) | deref()

The example given is sort of to demonstrate this only. Most of the time, just use apply with columns instead. But sometimes you need direct access to a column, so this is how you can do it.

class k1lib.cli.structural.reshape(*dims)[source]

Bases: BaseCli

__init__(*dims)[source]

Reshapes the input stream into the desired shape. Example:

# returns [[0, 1, 2], [3, 4, 5]]
range(6) | reshape(2, 3) | deref()
# returns [[0, 1], [2, 3], [4, 5]]
range(6) | reshape(3, 2) | deref()
# returns [[0, 1], [2, 3], [4, 5]], stopped early
range(100) | reshape(3, 2) | deref()
# returns [[0, 1, 2], [3, 4, 5]], can leave out first dimension
range(6) | reshape(-1, 3) | deref()
# returns [[0, 1, 2]], won't include 2nd element, as it ran out of elements
range(5) | reshape(-1, 3) | deref()
# throws error, as it ran out of elements and can't fulfill the request
range(6) | reshape(3, 3) | deref()

Unlike torch.reshape(), the input piped into this has to be a simple iterator. If you have a complex data structure with multiple dimensions, turn that into a simple iterator with joinStreams first, like this:

# returns [[[0, 1, 2]], [[3, 4, 5]]]
[[[0], [1]], [[2], [3]], [[4], [5]]] | joinStreams(2) | reshape(2, 1, 3) | deref()
__ror__(it)[source]
class k1lib.cli.structural.insert(element, begin=True)[source]

Bases: BaseCli

__init__(element, begin=True)[source]

Join element into list. Example:

# returns [5, 2, 6, 8]
[2, 6, 8] | insert(5) | deref()
# returns [2, 6, 8, 5]
[2, 6, 8] | insert(5, begin=False) | deref()

# returns [[3, 1], 2, 6, 8]
[2, 6, 8] | insert([3, 1]) | deref()
Parameters

element – the element to insert

__ror__(it: Tuple[T, Iterator[T]]) Iterator[T][source]
class k1lib.cli.structural.splitW(*weights: List[float])[source]

Bases: BaseCli

__init__(*weights: List[float])[source]

Splits elements into multiple weighted lists. If no weights are provided, then automatically defaults to [0.8, 0.2]. Example:

# returns [[0, 1, 2, 3, 4, 5, 6, 7], [8, 9]]
range(10) | splitW(0.8, 0.2) | deref()
# same as the above
range(10) | splitW() | deref()

This also works with array types:

torch.randn(100, 3) | splitW() # returns 2 tensors with shapes (80, 3) and (20, 3)

See also: splitC

__ror__(it)[source]
class k1lib.cli.structural.splitC(*checkpoints: List[float])[source]

Bases: BaseCli

__init__(*checkpoints: List[float])[source]

Splits elements into multiple checkpoint-delimited lists. Example:

# returns [[0, 1], [2, 3, 4], [5, 6, 7, 8, 9]]
range(10) | splitC(2, 5) | deref()
# returns ['01', '234', '56789']
"0123456789" | splitC(2, 5) | deref()

Here, you’re specifying 2 checkpoints, 2 and 5, so it will split the list up into 3 sections. First section is 0-2, second section is 2-5, third section is 5-end. You can pass in fractional checkpoints too:

# returns [[0, 1], [2, 3, 4, 5], [6, 7, 8, 9]]
range(10) | splitC(0.2, 0.6) | deref()

This cli might be unintuitive to remember, so if you want to just split it up into 2 parts, check out split().

If you want to split things up by weighted length, check out splitW

__ror__(it)[source]
class k1lib.cli.structural.joinStreams(dims=1)[source]

Bases: BaseCli

__init__(dims=1)[source]

Joins multiple streams. Example:

# returns [1, 2, 3, 4, 5]
[[1, 2, 3], [4, 5]] | joinStreams() | deref()
# returns [[0, 1], [2], [3, 4, 5], [6, 7, 8], [], [9, 10]]
[[[0, 1], [2], [3, 4, 5]], [[6, 7, 8], [], [9, 10]]] | joinStreams() | deref()
# returns [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
[[[0, 1], [2], [3, 4, 5]], [[6, 7, 8], [], [9, 10]]] | joinStreams(2) | deref()

If you pass in numpy.ndarray or torch.Tensor, then it will automatically use the C-accelerated version, like this:

# returns Tensor with shape (6, 4)
torch.randn(2, 3, 4) | joinStreams()
# returns array with shape (6, 4)
np.random.randn(2, 3, 4) | joinStreams()

Sometimes, you may want to impose some dimensional structure after joining all streams together, which reshape does.

If “joinStreams” is too unintuitive to remember, there’s also an alias called flatten.

Parameters

dims – how many joinStreams() do you want to do consecutively?

__ror__(streams: Iterator[Iterator[T]]) Iterator[T][source]
k1lib.cli.structural.flatten

alias of joinStreams

class k1lib.cli.structural.activeSamples(limit: int = 100, p: float = 0.95)[source]

Bases: BaseCli

__init__(limit: int = 100, p: float = 0.95)[source]

Yields active learning samples. Example:

o = activeSamples()
ds = range(10) # normal dataset
ds = [o, ds] | joinStreamsRandom() # dataset with active learning capability
next(ds) # returns 0
next(ds) # returns 1
next(ds) # returns 2
o.append(20)
next(ds) # can return     3     or 20
next(ds) # can return (4 or 20) or 4

So the point of this is to be a generator of samples. You can define your dataset as a mix of active learning samples and standard samples. Whenever there’s a data point that you want to focus on, you can add it to o and it will eventially yield it.

Warning

It might not be a good idea to set param limit to higher numbers than 100. This is because, the network might still not understand a wrong sample after being shown multiple times, and will keep adding that wrong sample back in, distracting it from other samples, and reduce network’s accuracy after removing active learning from it.

If limit is low enough (from my testing, 30-100 should be fine), then old wrong samples will be kicked out, allowing for a fresh stream of wrong samples coming in, and preventing the problem above. If you found that removing active learning makes the accuracy drops dramatically, then try decreasing the limit.

Parameters
  • limit – max number of active samples. Discards samples if number of samples is over this.

  • p – probability of actually adding the samples in

append(item)[source]

Adds 1 sample.

extend(items)[source]

Adds multiple samples.

k1lib.cli.structural.table(delim: Optional[str] = None)[source]

Basically op().split(delim).all(). This exists because this is used quite a lot in bioinformatics. Example:

# returns [['a', 'bd'], ['1', '2', '3']]
["a|bd", "1|2|3"] | table("|") | deref()
class k1lib.cli.structural.batched(bs=32, includeLast=False)[source]

Bases: BaseCli

__init__(bs=32, includeLast=False)[source]

Batches the input stream. Example:

# returns [[0, 1, 2], [3, 4, 5], [6, 7, 8]]
range(11) | batched(3) | deref()
# returns [[0, 1, 2], [3, 4, 5], [6, 7, 8], [9, 10]]
range(11) | batched(3, True) | deref()
# returns [[0, 1, 2, 3, 4]]
range(5) | batched(float("inf"), True) | deref()
# returns []
range(5) | batched(float("inf"), False) | deref()

Can work well and fast with torch.Tensor and numpy.ndarray:

# both returns torch.Tensor of shape (2, 3, 4, 5)
torch.randn(6, 4, 5) | batched(3)
torch.randn(7, 4, 5) | batched(3)

Also, if input is a range, then to save time, a bunch of other ranges will be returned, instead of a bunch of lists, for performance:

# returns [range(0, 3), range(3, 6), range(6, 9)]
range(11) | batched(3) | toList()
__ror__(it)[source]
class k1lib.cli.structural.window(n, newList=False, pad=<object object>)[source]

Bases: BaseCli

__init__(n, newList=False, pad=<object object>)[source]

Slides window of size n forward and yields the windows. Example:

# returns [[0, 1, 2], [1, 2, 3], [2, 3, 4]]
range(5) | window(3) | deref()
# returns [[0, 1, 2], [1, 2, 3], [2, 3, 4], [3, 4, None], [4, None, None]]
range(5) | window(3, pad=None) | deref()

If you are doing strange transformations to the result, like transposing it, then it might complain that the internal deque (double-ended queue) mutated during iteration. In that case, then set newList to True. It’s not True by default because multiple lists will be created, all of which needs memory allocation, which will be slower:

# takes 15ms
range(100000) | window(100) | ignore()
# takes 48ms, because of allocating lists
range(100000) | window(100) | ignore()
Parameters
  • n – size of the window

  • newList – whether to create a new list out of every window or not. If False (default), less robust but faster. If True, more robust but slower

  • pad – whether to pad the output stream on the end, so that it has the same number of elements as the input stream or not

__ror__(it)[source]
class k1lib.cli.structural.groupBy(column: int, separate: bool = False, removeCol: Optional[bool] = None)[source]

Bases: BaseCli

__init__(column: int, separate: bool = False, removeCol: Optional[bool] = None)[source]

Groups table by some column. Example:

a = [[2.3, 5],
     [3.4, 2],
     [4.5, 2],
     [5.6, 5],
     [6.7, 1]]
a | groupBy(1) | deref()

This returns:

[[[6.7, 1]],
 [[3.4, 2], [4.5, 2]],
 [[2.3, 5], [5.6, 5]]]

Should have O(n log(n)) time complexity. What if separate is True:

a | groupBy(1, True) | deref()

This returns:

[[1, [[6.7]]],
 [2, [[3.4], [4.5]]],
 [5, [[2.3], [5.6]]]]

What if removeCol is False:

a | groupBy(1, True, False) | deref()

This returns:

[[1, [[6.7, 1]]],
 [2, [[3.4, 2], [4.5, 2]]],
 [5, [[2.3, 5], [5.6, 5]]]]

There’s another perspective and way to think about this operation. A lot of libraries (like pandas) expect the uncompressed, “flat” version (the variable a in the examples above). But throughout my time using cli, the grouped version (separate=True) is usually much more useful and amenable to transformations. It also occupies less memory too, as the columns with duplicated elements are deleted.

So, you can sort of think groupBy is converting pandas dataframes into a more easily digestible form. But because the prevalence of those libraries, after doing all the transformations you want, sometimes it’s necessary to flatten it again, which ungroup does.

If you want to group text lines by some pattern im them, grep might be better for you.

Parameters
  • column – which column to group by

  • separate – whether to separate out the column to sort of form a dict or not. See example

  • removeCol – whether to remove the grouped-by column. Defaults to True if separate=True, and False if separate=False

__ror__(it)[source]
class k1lib.cli.structural.ungroup(single=False, begin=False, insertCol: bool = True)[source]

Bases: BaseCli

__init__(single=False, begin=False, insertCol: bool = True)[source]

Ungroups things that were grouped using a specific mode of groupBy. Particularly useful to transform some complex data structure into a flat dataframe so that you can plug into pandas. Example:

a = [[2.3, 5], [3.4, 2], [4.5, 2], [5.6, 5], [6.7, 1]]
# returns [[6.7, 1], [3.4, 2], [4.5, 2], [2.3, 5], [5.6, 5]]
a | groupBy(1, True) | ungroup() | deref()
# returns [[6.7], [3.4], [4.5], [2.3], [5.6]]
a | groupBy(1, True) | ungroup(False) | deref()

Just as a reminder, this is the output of groupBy after executing a | groupBy(1, True):

[[1, [[6.7]]],
 [2, [[3.4], [4.5]]],
 [5, [[2.3], [5.6]]]]

A lot of times, your data is a little bit different, like this perhaps:

[[1, [6.7]],
 [2, [3.4, 4.5]],
 [5, [2.3, 5.6]]]

A way to fix this would be to add apply(wrapList().all(), 1) before ungroup. But because this is so common, I’ve added in the parameter single for that. Just set it to True:

# returns [[6.7, 1], [3.4, 2], [4.5, 2], [2.3, 5], [5.6, 5]]
[[1, [6.7]],
 [2, [3.4, 4.5]],
 [5, [2.3, 5.6]]] | ungroup(single=True)
Parameters
  • single – whether the table in each group has a single column or not

  • begin – whether to insert the column at the beginning or at the end. Only works if insertCol is True

  • insertCol – whether to insert the column into the table or not

__ror__(it)[source]
class k1lib.cli.structural.insertColumn(column: List[T], begin=True, fill='')[source]

Bases: BaseCli

__init__(column: List[T], begin=True, fill='')[source]

Inserts a column at beginning or end. Example:

# returns [['a', 1, 2], ['b', 3, 4]]
[[1, 2], [3, 4]] | insertColumn(["a", "b"]) | deref()
# returns [[1, 2, 'a'], [3, 4, 'b']]
[[1, 2], [3, 4]] | insertColumn(["a", "b"], begin=False) | deref()
__ror__(it)[source]
k1lib.cli.structural.insertIdColumn(table=False, begin=True)[source]

Inserts an id column at the beginning (or end). Example:

# returns [[0, 'a', 2], [1, 'b', 4]]
[["a", 2], ["b", 4]] | insertIdColumn(True) | deref()
# returns [[0, 'a'], [1, 'b']]
"ab" | insertIdColumn()
Parameters

table – if False, then insert column to an Iterator[str], else treat input as a full fledged table

class k1lib.cli.structural.expandE(f: Callable[[T], List[T]], column: int)[source]

Bases: BaseCli

__init__(f: Callable[[T], List[T]], column: int)[source]

Expands table element to multiple columns. Example:

# returns [['abc', 3, -2], ['de', 2, -5]]
[["abc", -2], ["de", -5]] | expandE(lambda e: (e, len(e)), 0) | deref()
Parameters

f – Function that transforms 1 row element to multiple elements

__ror__(it)[source]
k1lib.cli.structural.unsqueeze(dim: int = 0)[source]

Unsqueeze input iterator. Example:

t = [[1, 2], [3, 4], [5, 6]]
# returns (3, 2)
t | shape()
# returns (1, 3, 2)
t | unsqueeze(0) | shape()
# returns (3, 1, 2)
t | unsqueeze(1) | shape()
# returns (3, 2, 1)
t | unsqueeze(2) | shape()

Behind the scenes, it’s really just wrapList().all(dim), but the “unsqueeze” name is a lot more familiar. Also note that the inverse operation “squeeze” is sort of item().all(dim), if you’re sure that this is desirable:

t = [[1, 2], [3, 4], [5, 6]]
# returns (3, 2)
t | unsqueeze(1) | item().all(1) | shape()
class k1lib.cli.structural.count[source]

Bases: BaseCli

__init__()[source]

Finds unique elements and returns a table with [frequency, value, percent] columns. Example:

# returns [[1, 'a', '33%'], [2, 'b', '67%']]
['a', 'b', 'b'] | count() | deref()
__ror__(it: Iterator[str])[source]
static join()[source]

Joins multiple counts together. Example:

# returns [[2, 'a', '33%'], [4, 'b', '67%']]
['a', 'b', 'b'] | repeat(2) | applyMp(count() | deref()) | count.join() | deref()

This is useful when you want to get the count of a really long list/iterator using multiple cores

class k1lib.cli.structural.hist(bins: int = 30)[source]

Bases: BaseCli

__init__(bins: int = 30)[source]

Bins a long 1d array. Effectively creating a historgram, without actually plotting it. Example:

np.random.randn(1000) | hist(5)

That returns something like:

(array([-2.31449761, -1.17406889, -0.03364017,  1.10678854,  2.24721726]),
 array([ 41, 207, 432, 265,  55]),
 1.1404287156493986)

This format goes with bar() directly like this:

np.random.randn(1000) | hist(10) | ~aS(plt.bar)

If you have tons of data that’s handled in multiple processes, but you want to get an overall histogram, you can do something like this:

# bad solution, runs slow, accurate
fileNames | applyMp(cat() | toFloat() | aS(list)) | joinStreams() | hist() | ~aS(plt.bar)
# good solution, runs fast, slightly inaccurate
fileNames | applyMp(cat() | toFloat() | hist(300)) | hist.join() | ~aS(plt.bar)

Let’s say in each process, you have 10M records, and that you have 1000 processes in total. In the first solution, you transfer all records (10B records total) to a single process, then calculate the histogram of them. The transfer overhead is going to be absolutely enourmous, as well as the computation. This really defeats the purpose of doing multiprocessing.

In the second solution, you “convert” 10M records into 600 numbers for each process, which scales up to 600k numbers for all processes. Although big, but certainly manageable with current hardware. So the data transfer cost is not a lot at all. The histogram merging part also executes relatively fast, as it only creates an internal array of 3M length. See over hist.join() for param details

Params bins

how many bins should the histogram has?

__ror__(it)[source]
static join(scale: float = 10000.0, bins: Optional[int] = None, log: bool = True, xlog: bool = False)[source]

Joins multiple histograms together. Example:

a = np.random.randn(1000); b = np.random.randn(1000)+3
[a, b] | joinStreams() | hist() | head(2) | ~aS(plt.plot) # ---------------------------------- Ground truth
[a, b] | hist(300).all() | hist.join(scale=1e4) | head(2) | ~aS(plt.plot) # ------------------ Log joining
[a, b] | hist(300).all() | hist.join(scale=1e4, log=False) | head(2) | ~aS(plt.plot, ".") # -- Linear joining
plt.legend(["Ground truth", "Log", "Linear"]); plt.grid(True); plt.ylabel("Frequency"); plt.xlabel("Value");

This results in this:

../_images/hist1.png

As you can see, this process is only approximate, but is accurate enough in everyday use. If you are a normal user, then this is probably enough. However, if you’re a mathematician and really care about the accuracy of this, read on.

Performance vs accuracy

As mentioned in hist, joining histograms from across processes can really speed things up big time. But the joining process is complicated, with multiple parameters and different tradeoffs for each config. In this example, scale = 1e4, bins = 30, OG bins = 300, log = True. “OG bins” is the number of bins coming into hist.join()

To get the best accuracy possible, you should set scale and OG bins high. If better performance is desired, you should first lower scale, then lower OG bins, then finally lower bins.

Log scale

Take a look at this piece of code:

a, b = np.random.randn(1000)*1, np.random.randn(3000000)*0.3+3
[a, b] | joinStreams() | hist() | head(2) | ~aS(plt.plot)
[a, b] | hist(300).all() | hist.join(scale=1e4) | head(2) | ~aS(plt.plot)
[a, b] | hist(300).all() | hist.join(scale=1e4, log=False) | head(2) | ~aS(plt.plot, ".")
plt.yscale("log"); plt.legend(["Ground truth", "Log", "Linear"]); plt.grid(True); plt.ylabel("Frequency"); plt.xlabel("Value");

This results in:

../_images/hist2.png

This shows how log mode is generally better than linear mode when the frequencies span across multiple orders of magnitude. So why not delete linear mode directly? Well, I have not formally proved that log scale case fully covers the linear case, although in practice it seems so. So just to be cautious, let’s leave it in

Scale

The setup is just like in the “Log scale” section, but with scale = 1e3 instead of the default 1e4:

../_images/hist3.png

Remember that the higher the scale, the more accurate, but also the longer it runs. If the difference in high and low frequencies are bigger than scale, then the low frequency values are dropped.

Parameters
  • scale – how big a range of frequencies do we want to capture?

  • bins – output bins. If not specified automatically defaults to 1/10 the original number of bins

  • log – whether to transform everything to log scale internally on the y axis

  • xlog – whether to transform everything to log scale internally on the x axis

class k1lib.cli.structural.permute(*permutations: List[int])[source]

Bases: BaseCli

__init__(*permutations: List[int])[source]

Permutes the columns. Acts kinda like torch.Tensor.permute(). Example:

# returns [['b', 'a'], ['d', 'c']]
["ab", "cd"] | permute(1, 0) | deref()
__ror__(it: Iterator[str])[source]
class k1lib.cli.structural.accumulate(columnIdx: int = 0, avg=False)[source]

Bases: BaseCli

__init__(columnIdx: int = 0, avg=False)[source]

Groups lines that have the same row[columnIdx], and add together all other columns, assuming they’re numbers. Example:

# returns [['a', 10.5, 9.5, 14.5], ['b', 1.1, 2.2, 3.3]]
[["a", 1.1, 2.2, 3.4],
 ["a", 1.1, 2.2, 7.8],
 ["a", 8.3, 5.1, 3.3],
 ["b", 1.1, 2.2, 3.3]] | accumulate(0) | deref()
Parameters
  • columnIdx – common column index to accumulate

  • avg – calculate average values instead of sum

__ror__(it: Iterator[str])[source]
class k1lib.cli.structural.AA_(*idxs: List[int], wraps=False)[source]

Bases: BaseCli

__init__(*idxs: List[int], wraps=False)[source]

Returns 2 streams, one that has the selected element, and the other the rest. Example:

# returns [5, [1, 6, 3, 7]]
[1, 5, 6, 3, 7] | AA_(1)
# returns [[5, [1, 6, 3, 7]]]
[1, 5, 6, 3, 7] | AA_(1, wraps=True)

You can also put multiple indexes through:

# returns [[1, [5, 6]], [6, [1, 5]]]
[1, 5, 6] | AA_(0, 2)

If you don’t specify anything, then all indexes will be sliced:

# returns [[1, [5, 6]], [5, [1, 6]], [6, [1, 5]]]
[1, 5, 6] | AA_()

As for why the strange name, think of this operation as “AĀ”. In statistics, say you have a set “A”, then “not A” is commonly written as A with an overline “Ā”. So “AA_” represents “AĀ”, and that it first returns the selection A.

Parameters

wraps – if True, then the first example will return [[5, [1, 6, 3, 7]]] instead, so that A has the same signature as Ā

__ror__(it: List[Any]) List[List[List[Any]]][source]
class k1lib.cli.structural.peek[source]

Bases: BaseCli

__init__()[source]

Returns (firstRow, iterator). This sort of peaks at the first row, to potentially gain some insights about the internal formats. The returned iterator is not tampered. Example:

e, it = iter([[1, 2, 3], [1, 2]]) | peek()
print(e) # prints "[1, 2, 3]"
s = 0
for e in it: s += len(e)
print(s) # prints "5", or length of 2 lists

You kinda have to be careful about handling the firstRow, because you might inadvertently alter the iterator:

e, it = iter([iter(range(3)), range(4), range(2)]) | peek()
e = list(e) # e is [0, 1, 2]
list(next(it)) # supposed to be the same as `e`, but is [] instead

The example happens because you have already consumed all elements of the first row, and thus there aren’t any left when you try to call next(it).

__ror__(it: Iterator[T]) Tuple[T, Iterator[T]][source]
class k1lib.cli.structural.peekF(f: Union[BaseCli, Callable[[T], T]])[source]

Bases: BaseCli

__init__(f: Union[BaseCli, Callable[[T], T]])[source]

Similar to peek, but will execute f(row) and return the input Iterator, which is not tampered. Example:

it = lambda: iter([[1, 2, 3], [1, 2]])
# prints "[1, 2, 3]" and returns [[1, 2, 3], [1, 2]]
it() | peekF(lambda x: print(x)) | deref()
# prints "1\n2\n3"
it() | peekF(headOut()) | deref()
__ror__(it: Iterator[T]) Iterator[T][source]
class k1lib.cli.structural.repeat(limit: Optional[int] = None)[source]

Bases: BaseCli

__init__(limit: Optional[int] = None)[source]

Yields a specified amount of the passed in object. If you intend to pass in an iterator, then make a list out of it first, as second copy of iterator probably won’t work as you will have used it the first time. Example:

# returns [[1, 2, 3], [1, 2, 3], [1, 2, 3]]
[1, 2, 3] | repeat(3) | toList()
Parameters

repeat – if None, then repeats indefinitely

__ror__(o: T) Iterator[T][source]
k1lib.cli.structural.repeatF(f, limit: Optional[int] = None, **kwargs)[source]

Yields a specified amount generated by a specified function. Example:

# returns [4, 4, 4]
repeatF(lambda: 4, 3) | toList()
# returns 10
repeatF(lambda: 4) | head() | shape(0)

f = lambda a: a+2
# returns [8, 8, 8]
repeatF(f, 3, a=6) | toList()
Parameters
  • limit – if None, then repeats indefinitely

  • kwargs – extra keyword arguments that you can pass into the function

See also: repeatFrom

class k1lib.cli.structural.repeatFrom(limit: Optional[int] = None)[source]

Bases: BaseCli

__init__(limit: Optional[int] = None)[source]

Yields from a list. If runs out of elements, then do it again for limit times. Example:

# returns [1, 2, 3, 1, 2]
[1, 2, 3] | repeatFrom() | head(5) | deref()
# returns [1, 2, 3, 1, 2, 3]
[1, 2, 3] | repeatFrom(2) | deref()

Note

For advanced users who wants to modify the resulting stream mid-way, read this section

Because this reuses elements inside the input iterator, it’s necessary that the input feels like a list and not an iterator. So in order to make this work:

# returns [1, 2, 3, 1, 2, 3]
iter([1, 2, 3]) | repeatFrom(2) | deref()

It’s necessary to turn the input iterator into a list. However, sometimes you may want to update the input iterator values, so as to make things extra dynamic, like this:

l = [1, 2, 3]
def g(): yield from l; yield from l
def h():
    for i, e in enumerate(g()):
        if i == 3: l.append(5) # modifies the list mid-way
        yield e

h() | deref() # returns [1, 2, 3, 1, 2, 3, 5]

But if you do this, it wouldn’t work:

l = [1, 2, 3]
def h():
    for i, e in enumerate(iter(l) | repeatFrom(2)):
        if i == 3: l.append(5)
        yield e
h() | deref() # returns [1, 2, 3, 1, 2, 3]

This is because internally, repeatFrom turns the iterator into a list, and continues yielding from that list, and thus won’t use the updated values. To do it, you have to make the input feels like a list (can get length):

l = [1, 2, 3]
def h():
    for i, e in enumerate(l | repeatFrom(2)):
        if i == 3: l.append(5)
        yield e
h() | deref() # returns [1, 2, 3, 1, 2, 3, 5]
Parameters

limit – if None, then repeats indefinitely

__ror__(it: Iterator[T]) Iterator[T][source]
class k1lib.cli.structural.oneHot(col, n: int = 0, group: Optional[str] = None, sep: bool = False)[source]

Bases: BaseCli

__init__(col, n: int = 0, group: Optional[str] = None, sep: bool = False)[source]

One-hot encode some column in a table. Example:

a = [
 [1, 2, "A"],
 [3, 4, "B"],
 [5, 6, "C"]]
b = [
 [7, 8, "A"],
 [9, 10, "B"],
 [11, 12, "B"]]
[*a, *b] | oneHot(2) | deref()
[*a, *b] | oneHot(2, 3, "abcd") | deref()

Last 2 statements both return this:

[[1, 2, 1, 0, 0],
 [3, 4, 0, 1, 0],
 [5, 6, 0, 0, 1],
 [7, 8, 1, 0, 0],
 [9, 10, 0, 1, 0],
 [11, 12, 0, 1, 0]]

You can also separate the encoded column out like this:

[*a, *b] | oneHot(2, sep=True) | deref()

Which returns this:

[[1, 2, [1, 0, 0]],
 [3, 4, [0, 1, 0]],
 [5, 6, [0, 0, 1]],
 [7, 8, [1, 0, 0]],
 [9, 10, [0, 1, 0]],
 [11, 12, [0, 1, 0]]]

The natural way to do this is to use with without n and group parameters. But sometimes, your one hot encoding is spreaded across multiple datasets in multiple dataloaders, and so the order and length of the encoding might not be the same, which will mess up your training process.

That’s why, you can specify group, which will share encoding information across all oneHot clis that have the same group name. If you choose to do this then you have to also specify what’s the size of the encoding, because the cli can’t really infer the size when it potentially has not seen all the data right?

Parameters
  • col – which column one hot encode and expand into

  • n – (optional) total number of different elements

  • group – (optional) group name

  • sep – (optional) whether to separate the variable out into its own list

__ror__(it)[source]
class k1lib.cli.structural.indexTable(*cols)[source]

Bases: BaseCli

__init__(*cols)[source]

Indexes a table by some columns. Example:

a = [
    [0, 3, 0.1],
    [0, 4, 0.2],
    [1, 3, 0.3],
    [1, 4, 0.4],
]
# returns {3: [[0, 3, 0.1], [1, 3, 0.3]], 4: [[0, 4, 0.2], [1, 4, 0.4]]}
a | indexTable(1)
# returns {0: [[0, 3, 0.1], [0, 4, 0.2]], 1: [[1, 3, 0.3], [1, 4, 0.4]]}
a | indexTable(0)
# returns {3: {0: [[0, 3, 0.1]], 1: [[1, 3, 0.3]]},    4: {0: [[0, 4, 0.2]], 1: [[1, 4, 0.4]]}}
a | indexTable(1, 0)
__ror__(it)[source]

trace module

class k1lib.cli.trace.trace(f=<k1lib.cli.utils.size object>, maxDepth=inf)[source]

Bases: _trace

last = None

Last instantiated trace object. Access this to view the previous (possibly nested) trace.

__init__(f=<k1lib.cli.utils.size object>, maxDepth=inf)[source]

Traces out how the data stream is transformed through complex cli tools. Example:

# returns [1, 4, 9, 16], normal command
range(1, 5) | apply(lambda x: x**2) | deref()
# traced command, will display how the shapes evolve through cli tools
range(1, 5) | trace() | apply(lambda x: x**2) | deref()

There’re a lot more instructions and code examples over the tutorial section. Go check it out!

This also works well with tOpt, and will actually display inferred type data in the graph:

range(5) | tOpt() | trace() | apply(op()**2)
Parameters

f – function to display the data stream. Defaulted to shape, and to iden if is None.

utils module

This is for all short and random quality-of-life utilities.

class k1lib.cli.utils.size(idx=None)[source]

Bases: BaseCli

__init__(idx=None)[source]

Returns number of rows and columns in the input. Example:

# returns (3, 2)
[[2, 3], [4, 5, 6], [3]] | shape()
# returns 3
[[2, 3], [4, 5, 6], [3]] | shape(0)
# returns 2
[[2, 3], [4, 5, 6], [3]] | shape(1)
# returns (2, 0)
[[], [2, 3]] | shape()
# returns (3,)
[2, 3, 5] | shape()
# returns 3
[2, 3, 5] | shape(0)
# returns (3, 2, 2)
[[[2, 1], [0, 6, 7]], 3, 5] | shape()
# returns (1, 3)
["abc"] | shape()
# returns (1, 2, 3)
[torch.randn(2, 3)] | shape()
# returns (2, 3, 5)
shape()(np.random.randn(2, 3, 5))

shape is an alias of this cli. Use whichever is more intuitive for you.

There’s also lengths, which is sort of a simplified/faster version of this, but only use it if you are sure that len(it) can be called.

Parameters

idx – if not specified, returns a tuple of ints. If specified, then returns the specific index of the tuple

__ror__(it: Iterator[str])[source]
k1lib.cli.utils.shape

alias of size

class k1lib.cli.utils.item(amt: int = 1, fill=<object object>)[source]

Bases: BaseCli

__init__(amt: int = 1, fill=<object object>)[source]

Returns the first element of the input iterator. Example:

# returns 0
range(5) | item()
# returns torch.Size([5])
torch.randn(3,4,5) | item(2) | shape()
# returns 3
[] | item(fill=3)
Parameters
  • amt – how many times do you want to call item() back to back?

  • fill – if iterator length is 0, return this

__ror__(it: Iterator[str])[source]
k1lib.cli.utils.rItem(idx: int)[source]

Combines rows(idx) | item(), as this is a pretty common pattern. Example:

iter(range(10)) | rItem(4) # returns 4
class k1lib.cli.utils.iden[source]

Bases: BaseCli

__init__()[source]

Yields whatever the input is. Useful for multiple streams. Example:

# returns range(5)
range(5) | iden()
__ror__(it: Iterator[Any])[source]
class k1lib.cli.utils.join(delim: Optional[str] = None)[source]

Bases: BaseCli

__init__(delim: Optional[str] = None)[source]

Merges all strings into 1, with delim in the middle. Basically str.join(). Example:

# returns '2\na'
[2, "a"] | join("\n")
__ror__(it: Iterator[str])[source]
class k1lib.cli.utils.wrapList[source]

Bases: BaseCli

__init__()[source]

Wraps inputs inside a list. There’s a more advanced cli tool built from this, which is unsqueeze(). Example:

# returns [5]
5 | wrapList()
__ror__(it: T) List[T][source]
class k1lib.cli.utils.equals[source]

Bases: object

__init__()[source]

Checks if all incoming columns/streams are identical

__ror__(streams: Iterator[Iterator[str]])[source]
class k1lib.cli.utils.reverse[source]

Bases: BaseCli

__init__()[source]

Reverses incoming list. Example:

# returns [3, 5, 2]
[2, 5, 3] | reverse() | deref()
__ror__(it: Iterator[str]) List[str][source]
class k1lib.cli.utils.ignore[source]

Bases: BaseCli

__init__()[source]

Just loops through everything, ignoring the output. Example:

# will just return an iterator, and not print anything
[2, 3] | apply(lambda x: print(x))
# will prints "2\n3"
[2, 3] | apply(lambda x: print(x)) | ignore()
__ror__(it: Iterator[Any])[source]
class k1lib.cli.utils.rateLimit(f, delay=0.1)[source]

Bases: BaseCli

__init__(f, delay=0.1)[source]

Limits the execution flow rate upon a condition. Example:

s = 0; semaphore = 0
def heavyAsyncOperation(i):
    global semaphore, s
    semaphore += 1
    s += i; time.sleep(1)
    semaphore -= 1; return i**2

# returns (20,), takes 1s to run
range(20) | applyTh(heavyAsyncOperation, 100) | shape()
# returns (20,), takes 4s to run (20/5 = 4)
range(20) | rateLimit(lambda: semaphore < 5) | applyTh(heavyAsyncOperation, 100) | shape()

The first test case is not rate-limited, so it will run all 20 threads at the same time, and all of them will finish after 1 second.

The second test case is rate-limited, so that there can only be 5 concurrently executing threads because of the semaphore count check. Therefore this takes around 4 seconds to run.

Parameters
  • f – checking function. Should return true if execution is allowed

  • delay – delay in seconds between calling f()

__ror__(it)[source]
static cpu(maxUtilization=90)[source]

Limits flow rate when cpu utilization is more than a specified percentage amount. Needs to install the package psutil to actually work. Example:

# returns [0, 1, 4, 9, 16]
range(5) | rateLimit.cpu() | apply(op()**2) | deref()
class k1lib.cli.utils.timeLimit(t)[source]

Bases: BaseCli

__init__(t)[source]

Caps the flow after a specified amount of time has passed. Example:

# returns 20, or roughly close to that
repeatF(lambda: time.sleep(0.1)) | timeLimit(2) | shape(0)
__ror__(it)[source]
k1lib.cli.utils.tab(pad: str = '    ')[source]

Indents incoming string iterator. Example:

# prints out indented 0 to 9
range(10) | tab() | headOut()
k1lib.cli.utils.indent(pad: str = '    ')

Indents incoming string iterator. Example:

# prints out indented 0 to 9
range(10) | tab() | headOut()
class k1lib.cli.utils.clipboard[source]

Bases: BaseCli

__init__()[source]

Saves the input to clipboard. Example:

# copies "abc" into the clipboard. Just use Ctrl+V to paste as usual
"abc" | clipboard()
__ror__(s)[source]
class k1lib.cli.utils.deref(maxDepth=inf, igT=True)[source]

Bases: BaseCli

__init__(maxDepth=inf, igT=True)[source]

Recursively converts any iterator into a list. Example:

# returns something like "<range_iterator at 0x7fa8c52ca870>"
iter(range(5))
# returns [0, 1, 2, 3, 4]
iter(range(5)) | deref()
# returns [2, 3], yieldT stops things early
[2, 3, yieldT, 6] | deref()

You can also specify a maxDepth:

# returns something like "<list_iterator at 0x7f810cf0fdc0>"
iter([range(3)]) | deref(0)
# returns [range(3)]
iter([range(3)]) | deref(1)
# returns [[0, 1, 2]]
iter([range(3)]) | deref(2)

There are a few classes/types that are considered atomic, and deref will never try to iterate over it. If you wish to change it, do something like:

settings.cli.atomic.deref = (int, float, ...)
Parameters
  • maxDepth – maximum depth to dereference. Starts at 0 for not doing anything at all

  • igT – short for “ignore tensor”. If True, then don’t loop over torch.Tensor and numpy.ndarray internals

__ror__(it: Iterator[T]) List[T][source]
__invert__() BaseCli[source]

Returns a BaseCli that makes everything an iterator. Not entirely sure when this comes in handy, but it’s there.

class k1lib.cli.utils.bindec(cats: List[Any], f=None)[source]

Bases: BaseCli

__init__(cats: List[Any], f=None)[source]

Binary decodes the input. Example:

# returns ['a', 'c']
5 | bindec("abcdef")
# returns 'a,c'
5 | bindec("abcdef", join(","))
Parameters
  • cats – categories

  • f – transformation function of the selected elements. Defaulted to toList, but others like join is useful too

__ror__(it)[source]
class k1lib.cli.utils.smooth(consecutives=None)[source]

Bases: BaseCli

__init__(consecutives=None)[source]

Smoothes out the input stream. Literally just a shortcut for:

batched(consecutives) | toMean().all()

Example:

# returns [4.5, 14.5, 24.5]
range(30) | smooth(10) | deref()

Smoothing over torch.Tensor or numpy.ndarray will be much faster, and produce high dimensional results:

# returns torch.Tensor with shape (2, 3, 4)
torch.randn(10, 3, 4) | smooth(4)

The default consecutive value is in settings.cli.smooth. This is useful if you are smoothing over multiple lists at the same time, like this:

# can change a single smooth value temporarily here, and all sequences will be smoothed in the same way
with settings.cli.context(smooth=5):
    x = list(np.linspace(-2, 2, 50))
    y = x | apply(op()**2) | deref()
    plt.plot(x | smooth() | deref(), y | smooth() | deref())
Parameters

consecutives – if not defined, then used the value inside settings.cli.smooth

__ror__(it)[source]
k1lib.cli.utils.disassemble(f=None)[source]

Disassembles anything piped into it. Normal usage:

def f(a, b):
    return a**2 + b
# both of these print out disassembled info
f | disassemble()
disassemble(f)

# you can pass in lambdas
disassemble(lambda x: x + 3)

# or even raw code
"lambda x: x + 3" | disassemble()
k1lib.cli.utils.tree(fL=10, dL=10, depth=inf, ff: ~typing.Callable[[str], bool] = <function <lambda>>, df: ~typing.Callable[[str], bool] = <function <lambda>>)[source]

Recursively gets all files and folders. Output format might be a bit strange, so this is mainly for visualization. Example:

"." | tree() | deref()
Parameters
  • fL – max number of file per directory included in output

  • dL – max number of child directories per directory included in output

  • depth – explore depth

  • ff – optional file filter function

  • df – optional directory filter function

class k1lib.cli.utils.lookup(d: dict, col: Optional[int] = None, fill=None)[source]

Bases: BaseCli

__init__(d: dict, col: Optional[int] = None, fill=None)[source]

Looks up items from a dictionary/object. Example:

d = {"a": 3, "b": 5, "c": 52}
# returns [3, 5, 52, 52, 3]
"abcca" | lookup(d) | deref()

# returns [[0, 3], [1, 5], [2, 52], [3, 52], [4, 3]]
[range(5), "abcca"] | transpose() | lookup(d, 1) | deref()
Parameters
  • d – any object that can be sliced with the inputs

  • col – if None, lookup on each row, else lookup a specific column only

  • fill – if None, throws error if looked up element is not available, else returns the fill value

__ror__(it)[source]
class k1lib.cli.utils.dictFields(*fields, default='')[source]

Bases: BaseCli

__init__(*fields, default='')[source]

Grab a bunch of dictionary fields. Example:

# returns [3, 1, '']
{"a": 1, "b": 2, "c": 3} | dictFields("c", "a", "d")
__ror__(d)[source]
class k1lib.cli.utils.backup[source]

Bases: BaseCli

__init__()[source]

Backs up a file/folder. Example:

"some/folderOrFile" | backup()
"some/folderOrFile" | backup.restore()

Really straightforward. Uses bash internally to copy files recursively, so not available on Windows.

__ror__(it)[source]
static restore()[source]

typehint module

Lots of type hint mechanisms to be used by the LLVM optimizer

class k1lib.cli.typehint.tBase(child=<class 'NoneType'>)[source]

Bases: object

check(v)[source]

Checks whether a specific object adhears to this type hint or not. Returns yieldT if object does not adhere. If it does, then return the object.

Note that in the case that the object is actually an iterator, it will return a new iterator containing all elements from the old iterator.

item()[source]

Gets the child type of this type. Basically what’s the type if it were to go through item. Example:

# returns tTensor(torch.float32, 2)
tTensor(torch.float32, 3).item()
expand(n) List[tBase][source]

Expands the type to a list with n elements. Example:

# returns [int, int, int, int]
tList(int).expand(4)
# returns [int, float, float, str]
tCollection(int, tExpand(float), str).expand(4)
class k1lib.cli.typehint.tAny[source]

Bases: tBase

check(v)[source]

Checks whether a specific object adhears to this type hint or not. Returns yieldT if object does not adhere. If it does, then return the object.

Note that in the case that the object is actually an iterator, it will return a new iterator containing all elements from the old iterator.

item()[source]

Gets the child type of this type. Basically what’s the type if it were to go through item. Example:

# returns tTensor(torch.float32, 2)
tTensor(torch.float32, 3).item()
class k1lib.cli.typehint.tList(child=<class 'NoneType'>)[source]

Bases: tBase

check(v)[source]

Checks whether a specific object adhears to this type hint or not. Returns yieldT if object does not adhere. If it does, then return the object.

Note that in the case that the object is actually an iterator, it will return a new iterator containing all elements from the old iterator.

class k1lib.cli.typehint.tIter(child=<class 'NoneType'>)[source]

Bases: tBase

check(v)[source]

Checks whether a specific object adhears to this type hint or not. Returns yieldT if object does not adhere. If it does, then return the object.

Note that in the case that the object is actually an iterator, it will return a new iterator containing all elements from the old iterator.

class k1lib.cli.typehint.tSet(child=<class 'NoneType'>)[source]

Bases: tBase

check(v)[source]

Checks whether a specific object adhears to this type hint or not. Returns yieldT if object does not adhere. If it does, then return the object.

Note that in the case that the object is actually an iterator, it will return a new iterator containing all elements from the old iterator.

class k1lib.cli.typehint.tCollection(*children)[source]

Bases: tBase

__init__(*children)[source]

Fixed-length collection of things. Let’s say you want a tuple with 5 values:

a = [3, [2, 3], "e", 2.0, b'3']

Then, this would be represented like this:

tCollection(int, tList(int), str, float, bytes)

This also works in conjunction with tExpand, like this:

a = [3, [2, 3], "e", 2.0, 3.0]
tCollection(int, tList(int), str, tExpand(float))
check(v)[source]

Checks whether a specific object adhears to this type hint or not. Returns yieldT if object does not adhere. If it does, then return the object.

Note that in the case that the object is actually an iterator, it will return a new iterator containing all elements from the old iterator.

reduce()[source]

Tries to reduce tCollection(int, int) to tIter(int) if possible

item()[source]

Gets the child type of this type. Basically what’s the type if it were to go through item. Example:

# returns tTensor(torch.float32, 2)
tTensor(torch.float32, 3).item()
expand(n: int) List[tBase][source]

Expands out this collection so that it has a specified length

class k1lib.cli.typehint.tExpand(child)[source]

Bases: tBase

__init__(child)[source]

Supplement to tCollection

check(v)[source]

Checks whether a specific object adhears to this type hint or not. Returns yieldT if object does not adhere. If it does, then return the object.

Note that in the case that the object is actually an iterator, it will return a new iterator containing all elements from the old iterator.

class k1lib.cli.typehint.tNpArray(child=None, rank=None)[source]

Bases: tBase

__init__(child=None, rank=None)[source]

Numpy array type. Example:

# returns np.array([2, 3])
tNpArray(np.int64, 1).check(np.array([2, 3]))
Parameters
  • child – the dtype of the array

  • rank – the rank/dimension of the array

check(v)[source]

Checks whether a specific object adhears to this type hint or not. Returns yieldT if object does not adhere. If it does, then return the object.

Note that in the case that the object is actually an iterator, it will return a new iterator containing all elements from the old iterator.

item()[source]

Gets the child type of this type. Basically what’s the type if it were to go through item. Example:

# returns tTensor(torch.float32, 2)
tTensor(torch.float32, 3).item()
expand(n)[source]

Expands the type to a list with n elements. Example:

# returns [int, int, int, int]
tList(int).expand(4)
# returns [int, float, float, str]
tCollection(int, tExpand(float), str).expand(4)
class k1lib.cli.typehint.tTensor(child=None, rank=None)[source]

Bases: tBase

__init__(child=None, rank=None)[source]

PyTorch tensor type. Example:

# returns torch.tensor([2.0, 3.0])
tTensor(torch.float32, 1).check(torch.tensor([2.0, 3.0]))
Parameters
  • child – the dtype of the array

  • rank – the rank/dimension of the tensor

check(v)[source]

Checks whether a specific object adhears to this type hint or not. Returns yieldT if object does not adhere. If it does, then return the object.

Note that in the case that the object is actually an iterator, it will return a new iterator containing all elements from the old iterator.

item()[source]

Gets the child type of this type. Basically what’s the type if it were to go through item. Example:

# returns tTensor(torch.float32, 2)
tTensor(torch.float32, 3).item()
expand(n)[source]

Expands the type to a list with n elements. Example:

# returns [int, int, int, int]
tList(int).expand(4)
# returns [int, float, float, str]
tCollection(int, tExpand(float), str).expand(4)
k1lib.cli.typehint.inferType(o)[source]

Tries to infer the type of the input. Example:

# returns tList(int)
inferType(range(10))
# returns tTensor(torch.float32, 2)
inferType(torch.randn(2, 3))
exception k1lib.cli.typehint.TypeHintException[source]

Bases: Exception

k1lib.cli.typehint.tLowest(*ts)[source]

Grabs the lowest possible shared type of all the example types. Example:

# returns tIter(float)
tLowest(tIter(float), tList(int))
class k1lib.cli.typehint.tCheck[source]

Bases: BaseCli

__init__()[source]

Tool similar to trace to check whether all type hint outputs of all clis are good or not. Example:

assert range(1, 3) | tCheck() | item() | op()*2 == 2

Mainly used in cli unit tests. Return type of statement will be tCheck, which might be undesirable, so you can pipe it to yieldT like this:

# returns tCheck object
range(1, 3) | tCheck() | item() | op()*2
# returns number "2"
range(1, 3) | tCheck() | item() | op()*2 | yieldT
__ror__(v)[source]
class k1lib.cli.typehint.tOpt[source]

Bases: BaseCli

n = 10
__init__()[source]

Optimizes clis. Let’s say you have something like this:

range(1000) | toList() | head() | deref()

For whatever reason you forgot that you’ve dereferenced everything in the middle, although you’re only using 10 first elements, so the code can’t be lazy anymore. You can apply optimizations to it like this:

range(1000) | tOpt() | toList() | head() | deref()

This will effectively turn it into this:

range(1000) | tOpt() | head() | deref()

Normally, you’d use it in this form instead:

# returns the optimized cli
f = "file.txt" | tOpt() | cat() | shape(0) | tOpt
# then you can do this to pass it through as usual
"other file.txt" | f

Checkout the llvm optimizer tutorial <llvm.html> for a more in-depth explanation of this

More over, this combines nicely with trace like this:

range(5) | tOpt() | trace() | apply(op()**2) | deref()
static addPass(p, klasses: List[BaseCli] = [], abstractness=3)[source]

Adds an optimization pass that acts upon multiple clis in series. Example:

# cs: list of clis, ts: list of input type hints, 1 for each cli
def o1(cs:List[BaseCli], ts:List[tBase], metadata={}):
    return [cs[1], cs[0]] # reorder the clis
tOpt.addPass(o1, [toList, head], 3)

Here, we’re declaring an optimization pass o1. You will be given a list of cli objects, the cli’s input type hints and some extra metadata. If you can optimize it, then you should return a list of new clis, else you should return None

Also, abstractness has varying number of legal values: - 1-5: generic optimizations - 6-10: analysis passes. Passes must not return anything

Higher abstraction optimizations will be called first, and then lower abstraction optimizations will be called later. So, the idea is, just like LLVM, you can do some analysis which will compute metadata that you can use in your optimization passes, which will return optimized clis if it can.

Within optimization passes, you can prioritize optimizations that look at the global picture first, before breaking the code up into tiny fragments with more detailed optimizations, at which point it’s hard to look at the global picture.

Parameters
  • p – the optimization pass

  • klasses – list of cli classes in series that will trigger the pass

  • abstractness – how abstract is this optimization

static clearPasses()[source]

Clears all passes

property out
property optCli

Grabs the optimized cli. Example:

# returns optimized cli
(range(5) | tOpt() | apply(op()**2) | deref()).optCli
# you can also do it like this:
range(5) | tOpt() | apply(op()**2) | deref() | tOpt.optCli
# or even shorter like this:
range(5) | tOpt() | apply(op()**2) | deref() | tOpt
__ror__(it)[source]

optimizations module

This is for optimizing the hell out of cli tools. Optimizations that focus around a specific cli should be included close to their definitions, so this is for optimizations that unusually span multiple clis, and serve as examples of how to create optimization passes.

See over the LLVM optimizer tutorial for more background.

k1lib.cli.optimizations.dummy()[source]

Does nothing. Only here so that you can read the source code

Elsewhere in the library

There might still be more cli tools scattered around the library. These are pretty rare, quite dynamic and most likely a cool extra feature, not a core functionality, so not worth it/can’t mention it here. Anyway, execute this:

cli.scatteredClis()

to get a list of them.