k1lib.cli module

The main idea of this package is to emulate the terminal (hence “cli”, or “command line interface”), but doing all of that inside Python itself. So this bash statement:

cat file.txt | head -5 > headerFile.txt

Turns into this statement:

cat("file.txt") | head(5) > file("headerFile.txt")

You can even integrate with existing shell commands:

ls("~") | cmd("grep so")

Here, “ls” will list out files inside the home directory, then pipes it into regular grep on linux, which is then piped back into Python as a list of strings. So it’s equivalent to this bash statement:

ls | grep so

“cat”, “head”, “file”, “ls” and “cmd” are all classes extended from BaseCli. All of them implements the “reverse or” operation, or __ror__. So essentially, these 2 statements are equivalent:

3 | obj
obj.__ror__(3)

Also, a lot of these tools (like apply and filt) assume that we are operating on a table. So this table:

col1

col2

col3

1

2

3

4

5

6

Is equivalent to this list:

[["col1", "col2", "col3"], [1, 2, 3], [4, 5, 6]]

transpose and mtmS provides more flexible ways to transform a table structure (but usually involves more code).

Also, the expected way to use these tools is to import everything directly into the current environment, like this:

from k1lib.imports import *

Because there are a lot of clis, you may sometimes unintentionally overwrite an exposed cli tool. No worries, every tool is also under the cli object, meaning you can use deref() or cli.deref().

Besides operating on string iterators alone, this package can also be extra meta, and operate on streams of strings, or streams of streams of anything. I think this is one of the most powerful concept of the cli workflow. If this interests you, check over this:

All clis tools should work totally fine with PyTorch tensors, but not numpy arrays. This is because numpy arrays actually implements __or__ operator, which overrides cli tools’ __ror__ operator. Workarounds might look like this:

# returns (2, 3, 5), works fine
torch.randn(2, 3, 5) | shape()
# will not work, returns weird numpy array of shape (2, 3, 5)
np.random.randn(2, 3, 5) | shape()
# returns (2, 3, 5), mitigation strategy #1
shape()(np.random.randn(2, 3, 5))
# returns (2, 3, 5), mitigation strategy #2
[np.random.randn(2, 3, 5)] | (item() | shape())

All settings are at settings under name “cli”.

Where to start?

Core clis include apply, applyS (its multiprocessing cousins applyMp and applyMpBatched are great too), op, filt, deref, item, shape, iden, cmd, so start reading there first. Then, skim over everything to know what you can do with these collection of tools. While you’re doing that, checkout trace(), for a quite powerful debugging tool.

There are several written tutorials about cli here, and I also made some video tutorials as well, so go check those out.

bio module

This is for functions that are actually biology-related

k1lib.cli.bio.go(term: int)[source]

Looks up a GO term

k1lib.cli.bio.quality(log=True)[source]

Get numeric quality of sequence. Example:

# returns [2, 2, 5, 30]
"##&?" | quality() | deref()
Parameters

log – whether to use log scale (0 -> 40), or linear scale (1 -> 0.0001)

k1lib.cli.bio.longFa()[source]

Takes in a fasta file and put each sequence on 1 line. File “gene.fa”:

>AF086833.2 Ebola virus - Mayinga, Zaire, 1976, complete genome
CGGACACACAAAAAGAAAGAAGAATTTTTAGGATC
TTTTGTGTGCGAATAACTATGAGGAAGATTAATAA
>something other gene
CGGACACACAAAAAGAAAGAAGA
TTTTGTGTGCGAATAACTATGAG

Code:

cat("gene.fa") | bio.longFa() | cli.headOut()

Prints out:

>AF086833.2 Ebola virus - Mayinga, Zaire, 1976, complete genome
CGGACACACAAAAAGAAAGAAGAATTTTTAGGATCTTTTGTGTGCGAATAACTATGAGGAAGATTAATAA
>something other gene
CGGACACACAAAAAGAAAGAAGATTTTGTGTGCGAATAACTATGAG
class k1lib.cli.bio.idx(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Indexes files with various formats.

static blast(fileName: Optional[str] = None, dbtype: Optional[str] = None)[source]

Uses makeblastdb to create a blast database from a fasta file. Example:

"file.fa" | bio.idx.blast()
bio.idx.blast("file.fa")
static bwa(fileName: Optional[str] = None)[source]

Uses bwa to index a fasta file. Example:

"file.fa" | bio.idx.bwa()
bio.idx.bwa("file.bwa")
static bam(fileName: Optional[str] = None)[source]

Uses samtools to index a bam file. Example:

"file.bam" | bio.idx.bam()
bio.idx.bam("file.bam")
class k1lib.cli.bio.transcribe(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Transcribes (DNA -> RNA) incoming rows. Example:

# returns "AUCG"
"ATCG" | transcribe()
# returns ["AUCG"]
["ATCG"] | transcribe() | deref()
__ror__(it: Union[Iterator[str], str])[source]
class k1lib.cli.bio.complement(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Get the reverse complement of DNA. Example:

# returns "TAGC"
"ATCG" | bio.complement()
# returns ["TAGC"]
["ATCG"] | bio.complement() | deref()
__ror__(it: Union[Iterator[str], str])[source]
class k1lib.cli.bio.translate(length: int = 0)[source]

Bases: k1lib.cli.init.BaseCli

__init__(length: int = 0)[source]

Translates incoming rows.

Parameters

length – 0 for short (L), 1 for med (Leu), 2 for long (Leucine)

__ror__(it: Iterator[str])[source]
class k1lib.cli.bio.medAa(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Converts short aa sequence to medium one

__ror__(it: Iterator[str])[source]
class k1lib.cli.bio.longAa(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Converts short aa sequence to long one

__ror__(it: Iterator[str])[source]

entrez module

This module is not really fleshed out, not that useful/elegant, and I just use cmd instead

k1lib.cli.entrez.esearch(db: str = 'nucleotide', query: str = 'PRJNA257197')[source]
k1lib.cli.entrez.efetch(db: Optional[str] = None, ids: Optional[Union[str, List[str]]] = None, format: Optional[str] = None)[source]

mgi module

All tools related to the MGI database. Expected to use behind the “mgi” module name, like this:

from k1lib.imports import *
["SOD1", "AMPK"] | mgi.batch()
class k1lib.cli.mgi.batch(headless=True)[source]

Bases: k1lib.cli.init.BaseCli

Queries MGI database, convert list of genes to MGI ids

__init__(headless=True)[source]
Parameters

headless – whether to run this operation headless, or actually display the browser

__ror__(it: List[str])[source]

filt module

This is for functions that cuts out specific parts of the table

class k1lib.cli.filt.filt(predicate: Callable[[T], bool], column: Optional[int] = None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(predicate: Callable[[T], bool], column: Optional[int] = None)[source]

Filters out lines. Examples:

# returns [2, 6]
[2, 3, 5, 6] | filt(lambda x: x%2 == 0) | deref()
# returns [3, 5]
[2, 3, 5, 6] | ~filt(lambda x: x%2 == 0) | deref()
# returns [[2, 'a'], [6, 'c']]
[[2, "a"], [3, "b"], [5, "a"], [6, "c"]] | filt(lambda x: x%2 == 0, 0) | deref()

You can also pass in op, for extra intuitiveness:

# returns [2, 6]
[2, 3, 5, 6] | filt(op() % 2 == 0) | deref()
# returns ['abc', 'a12']
["abc", "def", "a12"] | filt(op().startswith("a")) | deref()
# returns ['abcd', '2bcr']
["abcd", "0123", "2bcr"] | filt("bc" in op()) | deref()
# returns [2, 3]
range(5) | filt(op() in [2, 8, 3]) | deref()
# returns [0, 1, 4]. Does not support `filt(op() not in [2, 8, 3])`. Use inverted filt instead!
range(5) | ~filt(op() in [2, 8, 3]) | deref()
Parameters

column

  • if integer, then predicate(row[column])

  • if None, then predicate(row)

__ror__(it: Iterator[T])Iterator[T][source]
__invert__()[source]

Negate the condition

k1lib.cli.filt.inSet(values: Set[Any], column: Optional[int] = None)k1lib.cli.filt.filt[source]

Filters out lines that is not in the specified set. Example:

# returns [2, 3]
range(5) | inSet([2, 8, 3]) | deref()
# returns [0, 1, 4]
range(5) | ~inSet([2, 8, 3]) | deref()

You can also use op like this, so you don’t have to remember this cli:

# returns [2, 3]
range(5) | filt(op() in [2, 8, 3]) | deref()
# returns [0, 1, 4]
range(5) | ~filt(op() in [2, 8, 3]) | deref()

However, this feature is very experimental

k1lib.cli.filt.contains(s: str, column: Optional[int] = None)k1lib.cli.filt.filt[source]

Filters out lines that don’t contain the specified substring. Sort of similar to grep, but this is simpler, and can be inverted. Example:

# returns ['abcd', '2bcr']
["abcd", "0123", "2bcr"] | contains("bc") | deref()

You can also use op like this:

# returns ['abcd', '2bcr']
["abcd", "0123", "2bcr"] | filt("bc" in op()) | deref()
class k1lib.cli.filt.empty(reverse=False)[source]

Bases: k1lib.cli.init.BaseCli

__init__(reverse=False)[source]

Filters out streams that is not empty. Almost always used inverted, but “empty” is a short, sweet name that’s easy to remember. Example:

# returns [[1, 2], ['a']]
[[], [1, 2], [], ["a"]] | ~empty() | deref()
Parameters

reverse – not intended to be used by the end user. Do ~empty() instead.

__ror__(streams: Iterator[Iterator[T]])Iterator[Iterator[T]][source]
__invert__()[source]
k1lib.cli.filt.isNumeric(column: Optional[int] = None)k1lib.cli.filt.filt[source]

Filters out a line if that column is not a number. Example:

# returns [0, 2, '3']
[0, 2, "3", "a"] | isNumeric() | deref()
k1lib.cli.filt.instanceOf(cls: Union[type, Tuple[type]], column: Optional[int] = None)k1lib.cli.filt.filt[source]

Filters out lines that is not an instance of the given type. Example:

# returns [2]
[2, 2.3, "a"] | instanceOf(int) | deref()
# returns [2, 2.3]
[2, 2.3, "a"] | instanceOf((int, float)) | deref()
k1lib.cli.filt.inRange(min: float = - inf, max: float = inf, column: Optional[int] = None)k1lib.cli.filt.filt[source]

Checks whether a column is in range or not. Example:

# returns [-2, 3, 6]
[-2, -8, 3, 6] | inRange(-3, 10) | deref()
# returns [-8]
[-2, -8, 3, 6] | ~inRange(-3, 10) | deref()

If you wish to just check against 1 bound, then use filt directly, like this:

# returns [3, 4]
range(5) | filt(op() >= 3) | deref()
class k1lib.cli.filt.head(n: int = 10)[source]

Bases: k1lib.cli.init.BaseCli

__init__(n: int = 10)[source]

Only outputs first n lines. You can also negate it (like ~head(5)), which then only outputs after first n lines. Examples:

"abcde" | head(2) | deref() # returns ["a", "b"]
"abcde" | ~head(2) | deref() # returns ["c", "d", "e"]
"0123456" | head(-3) | deref() # returns ['0', '1', '2', '3']
"0123456" | ~head(-3) | deref() # returns ['4', '5', '6']
"012" | head(None) | deref() # returns ['0', '1', '2']
"012" | ~head(None) | deref() # returns []
__ror__(it: Iterator[T])Iterator[T][source]
__invert__()[source]
class k1lib.cli.filt.columns(*columns: List[int])[source]

Bases: k1lib.cli.init.BaseCli

__init__(*columns: List[int])[source]

Cuts out specific columns, sliceable. Examples:

["0123456789"] | cut(5, 8) | deref() # returns [['5', '8']]
["0123456789"] | cut(2) | deref() # returns ['2']
["0123456789"] | cut(5, 8) | deref() # returns [['5', '8']]
["0123456789"] | ~cut()[:7:2] | deref() # returns [['1', '3', '5', '7', '8', '9']]

If you’re selecting only 1 column, then Iterator[T] will be returned, not Table[T].

__ror__(it: k1lib.cli.init.Table[T])k1lib.cli.init.Table[T][source]
__invert__()[source]
k1lib.cli.filt.cut

alias of k1lib.cli.filt.columns

class k1lib.cli.filt.rows(*rows: List[int])[source]

Bases: k1lib.cli.init.BaseCli

__init__(*rows: List[int])[source]

Cuts out specific rows. Space complexity O(1) as a list is not constructed (unless you’re using some really weird slices).

Parameters

rows – ints for the row indices

Example:

"0123456789" | rows(2) | deref() # returns ["2"]
"0123456789" | rows(5, 8) | deref() # returns ["5", "8"]
"0123456789" | rows()[2:5] | deref() # returns ["2", "3", "4"]
"0123456789" | ~rows()[2:5] | deref() # returns ["0", "1", "5", "6", "7", "8", "9"]
"0123456789" | ~rows()[:7:2] | deref() # returns ['1', '3', '5', '7', '8', '9']
"0123456789" | rows()[:-4] | deref() # returns ['0', '1', '2', '3', '4', '5']
"0123456789" | ~rows()[:-4] | deref() # returns ['6', '7', '8', '9']
__invert__()[source]
__ror__(it: Iterator[str])[source]
class k1lib.cli.filt.intersection(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Returns the intersection of multiple streams. Example:

# returns set([2, 4, 5])
[[1, 2, 3, 4, 5], [7, 2, 4, 6, 5]] | intersection()
__ror__(its: Iterator[Iterator[Any]])Set[Any][source]
class k1lib.cli.filt.union(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Returns the union of multiple streams. Example:

# returns {0, 1, 2, 10, 11, 12, 13, 14}
[range(3), range(10, 15)] | union()
__ror__(its: Iterator[Iterator[Any]])Set[Any][source]
class k1lib.cli.filt.unique(column: int)[source]

Bases: k1lib.cli.init.BaseCli

__init__(column: int)[source]

Filters out non-unique row elements. Example:

# returns [[1, "a"], [2, "a"]]
[[1, "a"], [2, "a"], [1, "b"]] | unique(0) | deref()
Parameters

column – doesn’t have the default case of None, because you can always use k1lib.cli.utils.toSet

__ror__(it: k1lib.cli.init.Table[T])k1lib.cli.init.Table[T][source]
class k1lib.cli.filt.breakIf(f)[source]

Bases: k1lib.cli.init.BaseCli

__init__(f)[source]

Breaks the input iterator if a condition is met. Example:

# returns [0, 1, 2, 3, 4, 5]
[*range(10), 2, 3] | breakIf(lambda x: x > 5) | deref()
__ror__(it: Iterator[T])Iterator[T][source]
class k1lib.cli.filt.mask(mask: Iterator[bool])[source]

Bases: k1lib.cli.init.BaseCli

__init__(mask: Iterator[bool])[source]

Masks the input stream. Example:

# returns [0, 1, 3]
range(5) | mask([True, True, False, True, False]) | deref()
# returns torch.tensor([0, 1, 3])
torch.tensor(range(5)) | mask([True, True, False, True, False])
__ror__(it)[source]

gb module

All tools related to GenBank file format. Expected to use behind the “gb” module name, like this:

from k1lib.imports import *
cat("abc.gb") | gb.feats()
class k1lib.cli.gb.feats(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Fetches features, each on a separate stream

__ror__(it)[source]
static filt(*terms: str)k1lib.cli.init.BaseCli[source]

Filters for specific terms in all the features texts. If there are multiple terms, then filters for first term, then second, then third, so the term’s order might matter to you

static tag(tag: str)k1lib.cli.init.BaseCli[source]

Gets a single tag out. Applies this on a single feature only

class k1lib.cli.gb.origin(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Return the origin section of the genbank file

__ror__(it)[source]

grep module

class k1lib.cli.grep.grep(pattern: str, before: int = 0, after: int = 0, N: int = inf, sep: bool = False)[source]

Bases: k1lib.cli.init.BaseCli

__init__(pattern: str, before: int = 0, after: int = 0, N: int = inf, sep: bool = False)[source]

Find lines that has the specified pattern. Example:

# returns ['d', 'd']
"abcde12d34" | grep("d") | deref()
# returns ['c', 'd', '2', 'd'], 2 sections of ['c', 'd'] and ['2', 'd']
"abcde12d34" | grep("d", 1) | deref()
# returns ['c', 'd']
"abcde12d34" | grep("d", 1, N=1) | deref()
# returns ['d', 'e', 'd', '3', '4'], 2 sections of ['d', 'e'] and ['d', '3', '4']
"abcde12d34" | grep("d", 0, 3).till("e") | deref()
# returns [['0', '1', '2'], ['3', '1', '4']]
"0123145" | grep("1", 2, 1, sep=True) | deref()

You can also separate out the sections:

# returns [['c', 'd'], ['2', 'd']]
"abcde12d34" | grep("d", 1, sep=True) | deref()
# returns [['c', 'd']]
"abcde12d34" | grep("d", 1, N=1, sep=True) | deref()
# returns [['1', '2', '3'], ['1', '4', '5']]
"0123145" | grep("1", sep=True).till() | deref()
Parameters
  • pattern – regex pattern to search for in a line

  • before – lines before the hit. Outputs independent lines

  • after – lines after the hit. Outputs independent lines

  • N – max sections to output

  • sep – whether to separate out the sections as lists

till(pattern: Optional[str] = None)[source]

Greps until some other pattern appear. Inclusive, so you might want to trim the last line. Example:

# returns ['5', '6', '7', '8'], includes last item
range(10) | join("") | grep("5").till("8") | deref()
# returns ['d', 'e', 'd', '3', '4']
"abcde12d34" | grep("d").till("e") | deref()
# returns ['d', 'e']
"abcde12d34" | grep("d", N=1).till("e") | deref()

If initial pattern and till pattern are the same, then you don’t have use this method at all. Instead, do something like this:

# returns ['1', '2', '3']
"0123145" | grep("1", after=1e9, N=1) | deref()
__ror__(it: Iterator[str])Iterator[str][source]
class k1lib.cli.grep.grepTemplate(pattern: str, template: str)[source]

Bases: k1lib.cli.init.BaseCli

__init__(pattern: str, template: str)[source]

Searches over all lines, pick out the match, and expands it to the templateand yields

__ror__(it: Iterator[str])[source]

init module

class k1lib.cli.init.BaseCli(fs: list = [])[source]

Bases: object

A base class for all the cli stuff. You can definitely create new cli tools that have the same feel without extending from this class, but advanced stream operations (like +, &, .all(), |) won’t work.

At the moment, you don’t have to call super().__init__() and super().__ror__(), as __init__’s only job right now is to solidify any op passed to it, and __ror__ does nothing.

__init__(fs: list = [])[source]

Not expected to be instantiated by the end user.

fs param

Expected to use it like this:

class A(BaseCli):
    def __init__(self, f):
        fs = [f]; super().__init__(fs); self.f = fs[0]

Where f is some (potentially exotic) function. This will replace f with a “normal” function that’s executable. See source code of filt for an example of why this is useful. Currently, it will:

  • Replace with last recorded 4 in op(), if f is True, because Python does not allow returning complex objects from __contains__ method

  • Solidifies every op.

__and__(cli: k1lib.cli.init.BaseCli)k1lib.cli.init.oneToMany[source]

Duplicates input stream to multiple joined clis. Example:

# returns [[5], [0, 1, 2, 3, 4]]
range(5) | (shape() & iden()) | deref()

Kinda like apply. There’re just multiple ways of doing this. This I think, is more intuitive, and apply is more for lambdas and columns mode. Performances are pretty much identical.

__add__(cli: k1lib.cli.init.BaseCli)k1lib.cli.init.mtmS[source]

Parallel pass multiple streams to multiple clis. Example:

# returns [8, 15]
[2, 3] | ((op() * 4) + (op() * 5)) | deref()
all(n: int = 1)k1lib.cli.init.BaseCli[source]

Applies this cli to all incoming streams. Example:

# returns (3,)
torch.randn(3, 4) | toMean().all() | shape()
# returns (3, 4)
torch.randn(3, 4, 5) | toMean().all(2) | shape()
Parameters

n – how many times should I chain .all()?

__or__(cli)k1lib.cli.init.serial[source]

Joins clis end-to-end. Example:

c = apply(op() ** 2) | deref()
# returns [0, 1, 4, 9, 16]
range(5) | c
__ror__(it)[source]
f()k1lib.cli.init.Table[k1lib.cli.init.Table[int]][source]

Creates a normal function \(f(x)\) which is equivalent to x | self.

__lt__(it)[source]

Backup pipe symbol >, purely for style, so that you can do something like this:

range(4) > file("a.txt")
__call__(it, *args)[source]

Another way to do it | cli. If multiple arguments are fed, then the argument list is passed to cli instead of just the first element. Example:

@applyS
def f(it):
    return it
f(2) # returns 2
f(2, 3) # returns [2, 3]
k1lib.cli.init.fastF(c, x=None)[source]

Tries to figure out what’s going on, is it a normal function, or an applyS, or a BaseCli, etc., and return a really fast function for execution. Example:

# both returns 16, fastF returns "lambda x: x**2", so it's really fast
fastF(op()**2)(4)
fastF(applyS(lambda x: x**2))(4)

At the moment, parameter x does nothing, but potentially in the future, you can pass in an example input to the cli, so that this returns an optimized, C compiled version.

Parameters

x – sample data for the cli

class k1lib.cli.init.serial(*clis: List[k1lib.cli.init.BaseCli])[source]

Bases: k1lib.cli.init.BaseCli

__init__(*clis: List[k1lib.cli.init.BaseCli])[source]

Merges clis into 1, feeding end to end. Used in chaining clis together without a prime iterator. Meaning, without this, stuff like this fails to run:

[1, 2] | a() | b() # runs
c = a() | b(); [1, 2] | c # doesn't run if this class doesn't exist
__ror__(it: Iterator[Any])Iterator[Any][source]
class k1lib.cli.init.oneToMany(*clis: List[k1lib.cli.init.BaseCli])[source]

Bases: k1lib.cli.init.BaseCli

__init__(*clis: List[k1lib.cli.init.BaseCli])[source]

Duplicates 1 stream into multiple streams, each for a cli in the list. Used in the “a & b” joining operator. See also: BaseCli.__and__()

__ror__(it: Iterator[Any])Iterator[Iterator[Any]][source]
class k1lib.cli.init.manyToMany(cli: k1lib.cli.init.BaseCli)[source]

Bases: k1lib.cli.init.BaseCli

__init__(cli: k1lib.cli.init.BaseCli)[source]

Applies multiple streams to a single cli. Used in the BaseCli.all() operator.

__ror__(it: Iterator[Iterator[Any]])Iterator[Iterator[Any]][source]
class k1lib.cli.init.mtmS(*clis: List[k1lib.cli.init.BaseCli])[source]

Bases: k1lib.cli.init.BaseCli

__init__(*clis: List[k1lib.cli.init.BaseCli])[source]

Applies multiple streams to multiple clis independently. Used in the “a + b” joining operator. See also: BaseCli.__add__().

Weird name is actually a shorthand for “many to many specific”.

__ror__(its: Iterator[Any])Iterator[Any][source]
static f(f, i: int, n: int = 100)[source]

Convenience method, so that this:

mtmS(iden(), op()**2, iden(), iden(), iden())
# also the same as this btw:
(iden() + op()**2 + iden() + iden() + iden())

is the same as this:

mtmS.single(op()**2, 1, 5)

Example:

# returns [5, 36, 7, 8, 9]
range(5, 10) | mtmS.single(op()**2, 1, 5) | deref()
Parameters
  • i – where should I put the function?

  • n – how many clis in total? Defaulted to 100

inp module

This module for tools that will likely start the processing stream.

k1lib.cli.inp.cat(fileName: Optional[str] = None, text: bool = True)[source]

Reads a file line by line. Example:

# display first 10 lines of file
cat("file.txt") | headOut()
# piping in also works
"file.txt" | cat() | headOut()

# rename file
cat("img.png", False) | file("img2.png", False)
Parameters
  • fileName – if None, then return a BaseCli that accepts a file name and outputs Iterator[str]

  • text – if True, read text file, else read binary file

k1lib.cli.inp.curl(url: str)Iterator[str][source]

Gets file from url. File can’t be a binary blob. Example:

# prints out first 10 lines of the website
curl("https://k1lib.github.io/") | headOut()
k1lib.cli.inp.wget(url: str, fileName: Optional[str] = None)[source]

Downloads a file. Also returns the file name, in case you want to pipe it to something else.

Parameters
  • url – The url of the file

  • fileName – if None, then tries to infer it from the url

k1lib.cli.inp.ls(folder: Optional[str] = None)[source]

List every file and folder inside the specified folder. Example:

# returns List[str]
ls("/home")
# same as above
"/home" | ls()
# only outputs files, not folders
ls("/home") | filt(os.path.isfile)
class k1lib.cli.inp.cmd(cmd: str, mode: int = 1, text=True, block=False)[source]

Bases: k1lib.cli.init.BaseCli

__init__(cmd: str, mode: int = 1, text=True, block=False)[source]

Runs a command, and returns the output line by line. Can pipe in some inputs. If no inputs then have to pipe in None. Example:

# return detailed list of files
None | cmd("ls -la")
# return list of files that ends with "ipynb"
None | cmd("ls -la") | cmd('grep ipynb$')

It might be tiresome to pipe in None all the time. So, you can use “>” operator to yield values right away:

# prints out first 10 lines of list of files
cmd("ls -la") > headOut()

If you’re using Jupyter notebook/lab, then if you were to display a cmd object, it will print out the outputs. So, a single command cmd("mkdir") displayed at the end of a cell is enough to trigger creating the directory.

Reminder that “>” operator in here sort of has a different meaning to that of BaseCli. So you kinda have to becareful about this:

# returns a serial cli, cmd not executed
cmd("ls -la") | deref()
# executes cmd with no input stream and pipes output to deref
cmd("ls -la") > deref()
# returns a serial cli
cmd("ls -la") > grep("txt") > headOut()
# executes pipeline
cmd("ls -la") > grep("txt") | headOut()

General advice is, right ater a cmd, use “>”, and use “|” everywhere else.

Let’s see a few more exotic examples. File a.sh:

#!/bin/bash

echo 1; sleep 0.5
echo This message goes to stderr >&2
echo 2; sleep 0.5
echo $(</dev/stdin)
sleep 0.5; echo 3

Examples:

# returns [b'1', b'2', b'45', b'3'] and prints out the error message
"45" | cmd("./a.sh", text=False) | deref()
# returns [b'This message goes to stderr']
"45" | cmd("./a.sh", mode=2, text=False) | deref()
# returns [[b'1', b'2', b'45', b'3'], [b'This message goes to stderr']]
"45" | cmd("./a.sh", mode=0, text=False) | deref()

Performance-wise, stdout and stderr will yield values right away as soon as the process outputs it, so you get real time feedback. However, this will convert the entire input into a bytes object, and not feed it bit by bit lazily, so if you have a humongous input, it might slow you down a little.

Settings: - cli.quiet: if True, won’t display errors in mode 1

Parameters
  • mode – if 0, returns (stdout, stderr). If 1, returns stdout and prints stderr if there are any errors. If 2, returns stderr

  • text – whether to decode the outputs into str or return raw bytes

  • block – whether to wait for the task to finish before returning to Python or not

__ror__(it: Union[None, str, bytes, Iterator[Any]])Iterator[Union[str, bytes]][source]

Pipes in lines of input, or if there’s nothing to pass, then pass None

k1lib.cli.inp.requireCli(cliTool: str)[source]

Searches for a particular cli tool (eg. “ls”), throws ImportError if not found, else do nothing

kcsv module

All tools related to csv file format. Expected to use behind the “kcsv” module name, like this:

from k1lib.imports import *
kcsv.cat("file.csv") | display()
k1lib.cli.kcsv.cat(file: str)k1lib.cli.init.Table[str][source]

Opens a csv file, and turns them into nice row elements

kxml module

All tools related to xml file format. Expected to use behind the “kxml” module name, like this:

from k1lib.imports import *
cat("abc.xml") | kxml.node() | kxml.display()
class k1lib.cli.kxml.node(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Turns lines into a single node

__ror__(it: Iterator[str])Iterator[xml.etree.ElementTree.Element][source]
class k1lib.cli.kxml.maxDepth(depth: Optional[int] = None, copy: bool = True)[source]

Bases: k1lib.cli.init.BaseCli

__init__(depth: Optional[int] = None, copy: bool = True)[source]

Filters out too deep nodes

Parameters
  • depth – max depth to include in

  • copy – whether to limit the nodes itself, or limit a copy

__ror__(nodes: Iterator[xml.etree.ElementTree.Element])Iterator[xml.etree.ElementTree.Element][source]
class k1lib.cli.kxml.tag(tag: str)[source]

Bases: k1lib.cli.init.BaseCli

__init__(tag: str)[source]

Finds all tags that have a particular name. If found, then don’t search deeper

__ror__(nodes: Iterator[xml.etree.ElementTree.Element])Iterator[xml.etree.ElementTree.Element][source]
class k1lib.cli.kxml.pretty(indent: Optional[str] = None)[source]

Bases: k1lib.cli.init.BaseCli

__ror__(it: Iterator[xml.etree.ElementTree.Element])Iterator[str][source]
class k1lib.cli.kxml.display(depth: int = 3, lines: int = 20)[source]

Bases: k1lib.cli.init.BaseCli

__init__(depth: int = 3, lines: int = 20)[source]

Convenience method for getting head, make it pretty and print it out

__ror__(it: Iterator[xml.etree.ElementTree.Element], lines=10)[source]

modifier module

This is for quick modifiers, think of them as changing formats

class k1lib.cli.modifier.applyS(f: Callable[[T], T])[source]

Bases: k1lib.cli.init.BaseCli

__init__(f: Callable[[T], T])[source]

Like apply, but much simpler, just operating on the entire input object, essentially. The “S” stands for “single”. Example:

# returns 5
3 | applyS(lambda x: x+2)

Like apply, you can also use this as a decorator like this:

@applyS
def f(x):
    return x+2
# returns 5
3 | f

This also decorates the returned object so that it has same qualname, docstring and whatnot.

__ror__(it: T)T[source]
class k1lib.cli.modifier.apply(f: Callable[[T], T], column: Optional[int] = None, cache: int = 0)[source]

Bases: k1lib.cli.init.BaseCli

__init__(f: Callable[[T], T], column: Optional[int] = None, cache: int = 0)[source]

Applies a function f to every line. Example:

# returns [0, 1, 4, 9, 16]
range(5) | apply(lambda x: x**2) | deref()
# returns [[3.0, 1.0, 1.0], [3.0, 1.0, 1.0]]
torch.ones(2, 3) | apply(lambda x: x+2, 0) | deref()

You can also use this as a decorator, like this:

@apply
def f(x):
    return x**2
# returns [0, 1, 4, 9, 16]
range(5) | f | deref()

You can also add a cache, like this:

def calc(i): time.sleep(0.5); return i**2
# takes 2.5s
range(5) | repeatFrom(2) | apply(calc, cache=10) | deref()
# takes 5s
range(5) | repeatFrom(2) | apply(calc) | deref()
Parameters
  • column – if not None, then applies the function to that column only

  • cache – if specified, then caches this much number of values

__ror__(it: Iterator[str])[source]
class k1lib.cli.modifier.applyMp(f: Callable[[T], T], prefetch: Optional[int] = None, timeout: float = 8, utilization: float = 0.8, bs: int = 1, **kwargs)[source]

Bases: k1lib.cli.init.BaseCli

__init__(f: Callable[[T], T], prefetch: Optional[int] = None, timeout: float = 8, utilization: float = 0.8, bs: int = 1, **kwargs)[source]

Like apply, but execute f(row) of each row in multiple processes. Example:

# returns [3, 2]
["abc", "de"] | applyMp(lambda s: len(s)) | deref()
# returns [5, 6, 9]
range(3) | applyMp(lambda x, bias: x**2+bias, bias=5) | deref()

# returns [[1, 2, 3], [1, 2, 3]], demonstrating outside vars work
someList = [1, 2, 3]
["abc", "de"] | applyMp(lambda s: someList) | deref()

Internally, this will continuously spawn new jobs up until 80% of all CPU cores are utilized. On posix systems, the default multiprocessing start method is fork(). This sort of means that all the variables in memory will be copied over. This might be expensive (might also not, with copy-on-write), so you might have to think about that. On windows and macos, the default start method is spawn, meaning each child process is a completely new interpreter, so you have to pass in all required variables and reimport every dependencies. Read more at https://docs.python.org/3/library/multiprocessing.html#contexts-and-start-methods

If you don’t wish to schedule all jobs at once, you can specify a prefetch amount, and it will only schedule that much jobs ahead of time. Example:

range(10000) | applyMp(lambda x: x**2)    | head() | deref() # 700ms
range(10000) | applyMp(lambda x: x**2, 5) | head() | deref() # 300ms

# demonstrating there're no huge penalties even if we want all results at the same time
range(10000) | applyMp(lambda x: x**2)    | deref() # 900ms
range(10000) | applyMp(lambda x: x**2, 5) | deref() # 1000ms

The first line will schedule all jobs at once, and thus will require more RAM and compute power, even though we discard most of the results anyway (the head cli). The second line only schedules 5 jobs ahead of time, and thus will be extremely more efficient if you don’t need all results right away.

Note

Remember that every BaseCli is also a function, meaning that you can do stuff like:

# returns [['ab', 'ac']]
[["ab", "cd", "ac"]] | applyMp(filt(op().startswith("a")) | deref()) | deref()

Also remember that the return result of f should not be a generator. That’s why in the example above, there’s a deref() inside f.

Most of the time, you would probably want to specify bs to something bigger than 1 (may be 32 or sth like that). This will executes f multiple times in a single job, instead of executing f only once per job. Should reduce overhead of process creation dramatically.

If you encounter strange errors not seen on apply, you can try to clear all pools (using clearPools()), to terminate all child processes and thus free resources. On earlier versions, you have to do this manually before exiting, but now applyMp is much more robust.

Also, you should not immediately assume that applyMp will always be faster than apply. Remember that applyMp will create new processes, serialize and transfer data to them, execute it, then transfer data back. If your code transfers a lot of data back and forth (compared to the amount of computation done), or the child processes don’t have a lot of stuff to do before returning, it may very well be a lot slower than apply.

Parameters
  • prefetch – if not specified, schedules all jobs at the same time. If specified, schedules jobs so that there’ll only be a specified amount of jobs, and will only schedule more if results are actually being used.

  • timeout – seconds to wait for job before raising an error

  • utilization – how many percent cores are we running? 0 for no cores, 1 for all the cores. Defaulted to 0.8

  • bs – if specified, groups bs number of transforms into 1 job to be more efficient.

  • kwargs – extra arguments to be passed to the function. args not included as there’re a couple of options you can pass for this cli.

__ror__(it: Iterator[T])Iterator[T][source]
static clearPools()[source]

Terminate all existing pools. Do this before restarting/quitting the script/notebook to make sure all resources (like GPU) are freed. Update: you probably won’t have to call this manually anymore since version 0.9, but if you run into problems, try doing this.

static pools()[source]

Get set of all pools. Meant for debugging purposes only.

class k1lib.cli.modifier.applyTh(f, prefetch: int = 2, timeout: float = 5, bs: int = 1)[source]

Bases: k1lib.cli.init.BaseCli

__init__(f, prefetch: int = 2, timeout: float = 5, bs: int = 1)[source]

Kinda like the same as applyMp, but executes f on multiple threads, instead of on multiple processes. Advantages:

  • Relatively low overhead for thread creation

  • Fast, if f is io-bound

  • Does not have to serialize and deserialize the result, meaning iterators can be exchanged

Disadvantages:

  • Still has thread creation overhead, so it’s still recommended to specify bs

  • Is slow if f has to obtain the GIL to be able to do anything

All examples from applyMp should work perfectly here.

__ror__(it)[source]
class k1lib.cli.modifier.applySerial(f, includeFirst=False, unpack=False)[source]

Bases: k1lib.cli.init.BaseCli

__init__(f, includeFirst=False, unpack=False)[source]

Applies a function repeatedly. First yields input iterator x. Then yields f(x), then f(f(x)), then f(f(f(x))) and so on. Example:

# returns [4, 8, 16, 32, 64]
2 | applySerial(op()*2) | head(5) | deref()

If the result of your operation is an iterator, you might want to deref it, like this:

rs = iter(range(8)) | applySerial(rows()[::2])
# returns [0, 2, 4, 6]
next(rs) | deref()
# returns []. This is because all the elements are taken by the previous deref()
next(rs) | deref()
# returns [[10, -6], [4, 16], [20, -12]]
[2, 8] | applySerial(lambda a, b: (a + b, a - b), unpack=True) | head(3) | deref()

rs = iter(range(8)) | applySerial(rows()[::2] | deref())
# returns [0, 2, 4, 6]
next(rs)
# returns [0, 4]
next(rs)
# returns [0]
next(rs)
Parameters
  • f – function to apply repeatedly

  • includeFirst – whether to include the raw input value or not

  • unpack – whether to unpack values into the function or not for aesthetic purposes

__ror__(it)[source]
k1lib.cli.modifier.replace(s: str, target: Optional[str] = None, column: Optional[int] = None)[source]

Replaces substring s with target for each line. Example:

# returns ['104', 'ab0c']
["1234", "ab23c"] | replace("23", "0") | deref()
Parameters

target – if not specified, then use the default delimiter specified in settings

k1lib.cli.modifier.remove(s: str, column: Optional[int] = None)[source]

Removes a specific substring in each line.

k1lib.cli.modifier.toFloat(*columns: List[int], force=False)[source]

Converts every row into a float. Example:

# returns [1, 3, -2.3]
["1", "3", "-2.3"] | toFloat() | deref()
# returns [[1.0, 'a'], [2.3, 'b'], [8.0, 'c']]
[["1", "a"], ["2.3", "b"], [8, "c"]] | toFloat(0) | deref()

With weird rows:

# returns [[1.0, 'a'], [8.0, 'c']]
[["1", "a"], ["c", "b"], [8, "c"]] | toFloat(0) | deref()
# returns [[1.0, 'a'], [0.0, 'b'], [8.0, 'c']]
[["1", "a"], ["c", "b"], [8, "c"]] | toFloat(0, force=True) | deref()
Parameters
  • columns – if nothing, then will convert each row. If available, then convert all the specified columns

  • force – if True, forces weird values to 0.0, else filters out all weird rows

k1lib.cli.modifier.toInt(*columns: List[int], force=False)[source]

Converts every row into an integer. Example:

# returns [1, 3, -2]
["1", "3", "-2.3"] | toInt() | deref()
Parameters
  • columns – if nothing, then will convert each row. If available, then convert all the specified columns

  • force – if True, forces weird values to 0, else filters out all weird rows

See also: toFloat()

class k1lib.cli.modifier.sort(column: int = 0, numeric=True, reverse=False)[source]

Bases: k1lib.cli.init.BaseCli

__init__(column: int = 0, numeric=True, reverse=False)[source]

Sorts all lines based on a specific column. Example:

# returns [[5, 'a'], [1, 'b']]
[[1, "b"], [5, "a"]] | ~sort(0) | deref()
# returns [[2, 3]]
[[1, "b"], [5, "a"], [2, 3]] | ~sort(1) | deref()
# errors out, as you can't really compare str with int
[[1, "b"], [2, 3], [5, "a"]] | sort(1, False) | deref()
# returns [-1, 2, 3, 5, 8]
[2, 5, 3, -1, 8] | sort(None) | deref()
Parameters
  • column – if None, sort rows based on themselves and not an element

  • numeric – whether to convert column to float

  • reverse – False for smaller to bigger, True for bigger to smaller. Use __invert__() to quickly reverse the order instead of using this param

__ror__(it: Iterator[str])[source]
__invert__()[source]

Creates a clone that has the opposite sort order

class k1lib.cli.modifier.sortF(f: Callable[[T], float], reverse=False)[source]

Bases: k1lib.cli.init.BaseCli

__init__(f: Callable[[T], float], reverse=False)[source]

Sorts rows using a function. Example:

# returns ['a', 'aa', 'aaa', 'aaaa', 'aaaaa']
["a", "aaa", "aaaaa", "aa", "aaaa"] | sortF(lambda r: len(r)) | deref()
# returns ['aaaaa', 'aaaa', 'aaa', 'aa', 'a']
["a", "aaa", "aaaaa", "aa", "aaaa"] | ~sortF(lambda r: len(r)) | deref()
__ror__(it: Iterator[T])Iterator[T][source]
__invert__()k1lib.cli.modifier.sortF[source]
class k1lib.cli.modifier.consume(f: Union[k1lib.cli.init.BaseCli, Callable[[T], None]])[source]

Bases: k1lib.cli.init.BaseCli

__init__(f: Union[k1lib.cli.init.BaseCli, Callable[[T], None]])[source]

Consumes the iterator in a side stream. Returns the iterator. Kinda like the bash command tee. Example:

# prints "0\n1\n2" and returns [0, 1, 2]
range(3) | consume(headOut()) | toList()
# prints "range(0, 3)" and returns [0, 1, 2]
range(3) | consume(lambda it: print(it)) | toList()

This is useful whenever you want to mutate something, but don’t want to include the function result into the main stream.

__ror__(it: T)T[source]
class k1lib.cli.modifier.randomize(bs=100)[source]

Bases: k1lib.cli.init.BaseCli

__init__(bs=100)[source]

Randomize input stream. In order to be efficient, this does not convert the input iterator to a giant list and yield random values from that. Instead, this fetches bs items at a time, randomizes them, returns and fetch another bs items. If you want to do the giant list, then just pass in float("inf"), or None. Example:

# returns [0, 1, 2, 3, 4], effectively no randomize at all
range(5) | randomize(1) | deref()
# returns something like this: [1, 0, 2, 3, 5, 4, 6, 8, 7, 9]. You can clearly see the batches
range(10) | randomize(3) | deref()
# returns something like this: [7, 0, 5, 2, 4, 9, 6, 3, 1, 8]
range(10) | randomize(float("inf")) | deref()
# same as above
range(10) | randomize(None) | deref()
__ror__(it: Iterator[T])Iterator[T][source]
class k1lib.cli.modifier.stagger(every: int)[source]

Bases: k1lib.cli.init.BaseCli

Staggers input stream into multiple stream “windows” placed serially. Best explained with an example:

o = range(10) | stagger(3)
o | deref() # returns [0, 1, 2], 1st "window"
o | deref() # returns [3, 4, 5], 2nd "window"
o | deref() # returns [6, 7, 8]
o | deref() # returns [9]
o | deref() # returns []

This might be useful when you’re constructing a data loader:

dataset = [range(20), range(30, 50)] | transpose()
dl = dataset | batched(3) | (transpose() | toTensor()).all() | stagger(4)
for epoch in range(3):
    for xb, yb in dl: # looping over a window
        print(epoch)
        # then something like: model(xb)

The above code will print 6 lines. 4 of them is “0” (because we stagger every 4 batches), and xb’s shape’ will be (3,) (because we batched every 3 samples).

You should also keep in mind that this doesn’t really change the property of the stream itself. Essentially, treat these pairs of statement as being the same thing:

o = range(11, 100)

# both returns 11
o | stagger(20) | item()
o | item()

# both returns [11, 12, ..., 20]
o | head(10) | deref()
o | stagger(20) | head(10) | deref()

Lastly, multiple iterators might be getting values from the same stream window, meaning:

o = range(11, 100) | stagger(10)
it1 = iter(o); it2 = iter(o)
next(it1) # returns 11
next(it2) # returns 12

This may or may not be desirable. Also this should be obvious, but I want to mention this in case it’s not clear to you.

__ror__(it: Iterator[T])k1lib.cli.modifier.StaggeredStream[source]
static tv(every: int, ratio: float = 0.8)[source]

Convenience method to quickly stagger train and valid datasets. Example:

# returns [[16], [4]]
[range(100)]*2 | stagger.tv(20) | shape().all() | deref()
class k1lib.cli.modifier.op[source]

Bases: k1lib._baseClasses.Absorber, k1lib.cli.init.BaseCli

Absorbs operations done on it and applies it on the stream. Based on Absorber. Example:

t = torch.tensor([[1, 2, 3], [4, 5, 6.0]])
# returns [torch.tensor([[4., 5., 6., 7., 8., 9.]])]
[t] | (op() + 3).view(1, -1).all() | deref()

Basically, you can treat op() as the input tensor. Tbh, you can do the same thing with this:

[t] | applyS(lambda t: (t+3).view(-1, 1)).all() | deref()

But that’s kinda long and may not be obvious. This can be surprisingly resilient, as you can still combine with other cli tools as usual, for example:

# returns [2, 3], demonstrating "&" operator
torch.randn(2, 3) | (op().shape & identity()) | deref() | item()

a = torch.tensor([[1, 2, 3], [7, 8, 9]])
# returns torch.tensor([4, 5, 6]), demonstrating "+" operator for clis and not clis
(a | op() + 3 + identity() | item() == torch.tensor([4, 5, 6])).all()

# returns [[3], [3]], demonstrating .all() and "|" serial chaining
torch.randn(2, 3) | (op().shape.all() | deref())

# returns [[8, 18], [9, 19]], demonstrating you can treat `op()` as a regular function
[range(10), range(10, 20)] | transpose() | filt(op() > 7, 0) | deref()

This can only deal with simple operations only. For complex operations, resort to the longer version applyS(lambda x: ...) instead!

Performance-wise, there are some, but not a lot of degradation, so don’t worry about it. Simple operations executes pretty much on par with native lambdas:

n = 10_000_000
# takes 1.48s
for i in range(n): i**2
# takes 1.89s, 1.28x worse than for loop
range(n) | apply(lambda x: x**2) | ignore()
# takes 1.86s, 1.26x worse than for loop
range(n) | apply(op()**2) | ignore()
# takes 1.86s
range(n) | (op()**2).all() | ignore()

More complex operations can take more of a hit:

# takes 1.66s
for i in range(n): i**2-3
# takes 2.02s, 1.22x worse than for loop
range(n) | apply(lambda x: x**2-3) | ignore()
# takes 2.81s, 1.69x worse than for loop
range(n) | apply(op()**2-3) | ignore()

Experimental features:

# returns [2, 3, 4] range(10) | filt(op() in range(2, 5)) | deref() # returns [0, 1, 5, 6, 7, 8, 9] range(10) | ~filt(op() in range(2, 5)) | deref() # will not work, so if your set potentially does not have any element, then don’t use op() range(10) | filt(op() in []) | deref()

Reserved operations that are not absorbed are:

  • all

  • __ror__ (__or__ still works!)

  • op_solidify

op_solidify()[source]

Use this to not absorb __call__ operations anymore and makes it feel like a regular function (still absorbs other operations though):

f = op()**2
3 | f # returns 9, but may be you don't want to pipe it in
f.op_solidify()
f(3)  # returns 9
__ror__(it)[source]
class k1lib.cli.modifier.integrate(dt=1)[source]

Bases: k1lib.cli.init.BaseCli

__init__(dt=1)[source]

Integrates the input. Example:

# returns [0, 1, 3, 6, 10, 15, 21, 28, 36, 45]
range(10) | integrate() | deref()
# returns [0, 2, 6, 12, 20, 30, 42, 56, 72, 90]
range(10) | integrate(2) | deref()
Parameters

dt – Optional small step

__ror__(it)[source]

nb module

This is for everything related to ipython notebooks. Expected to use behind the “nb” module name, like this:

from k1lib.imports import *
nb.execute("file.ipynb")
k1lib.cli.nb.cells(fileName)[source]

Gets simplified notebook cells from file source, including fields cell_type and source only. Example:

nb.cells("file.ipynb")
class k1lib.cli.nb.pretty(magics: bool = False, whitelist: List[str] = [], blacklist: List[str] = [])[source]

Bases: k1lib.cli.init.BaseCli

__init__(magics: bool = False, whitelist: List[str] = [], blacklist: List[str] = [])[source]

Makes the cells prettier. Cell 1 in file.ipynb:

#notest, export
a = 3

Cell 2 in file.ipynb:

b = 6

Code:

# only cell 2 gets chosen
nb.cells("file.ipynb") | nb.pretty(blacklist=["notest"])
# only cell 1 gets chosen
nb.cells("file.ipynb") | nb.pretty(whitelist=["export"])
Parameters
  • magics – if False, then if detected magics (‘!’, ‘%%’ symbols), then remove that line in cell’s source

  • whitelist – every cell that doesn’t have any of these properties will be filtered out

  • blacklist – every cell that has any of these properties will be filtered out

__ror__(cells)[source]
class k1lib.cli.nb.execute(fileName=None, _globals: Optional[dict] = None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(fileName=None, _globals: Optional[dict] = None)[source]

Executes cells. Example:

nb.cells("file.ipynb") | nb.execute("nb.ipynb")

Most of the time, you’d want to pass cells through pretty first, to make sure everything is nice and clean

Parameters
  • fileName – not actually used to read the file. If specified, then changes the current working directory to that of the file

  • _globals – optional dict of global variables

__ror__(cells)[source]

output module

For operations that feel like the termination

class k1lib.cli.output.stdout(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Prints out all lines. If not iterable, then print out the input raw. Example:

# prints out "0\n1\n2"
range(3) | stdout()
# same as above, but (maybe?) more familiar
range(3) > stdout()
__ror__(it: Iterator[str])[source]
class k1lib.cli.output.tee(f=<function tee.<lambda>>, s=None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(f=<function tee.<lambda>>, s=None)[source]

Like the Linux tee command, this prints the elements to another specified stream, while yielding the elements. Example:

# prints "0\n1\n2\n3\n4\n" and returns [0, 1, 4, 9, 16]
range(5) | tee() | apply(op() ** 2) | deref()
Parameters
  • f – element transform function. Defaults to just adding a new line at the end

  • s – stream to write to. Defaults to sys.stdout

__ror__(it)[source]
static cr()[source]

Tee, but replaces the previous line. “cr” stands for carriage return. Example:

# prints "4" and returns [0, 1, 4, 9, 16]. Does print all the numbers in the middle, but is overriden
range(5) | tee.cr() | apply(op() ** 2) | deref()
static crt()[source]

Like tee.cr(), but includes an elapsed time text at the end

class k1lib.cli.output.file(fileName: Optional[str] = None, text: bool = True)[source]

Bases: k1lib.cli.init.BaseCli

__init__(fileName: Optional[str] = None, text: bool = True)[source]

Opens a new file for writing. Example:

# writes "0\n1\n2\n" to file
range(3) | file("test/f.txt")
# same as above, but (maybe?) more familiar
range(3) > file("text/f.txt")
# returns ['0', '1', '2']
cat("folder/f.txt") | deref()

# writes bytes to file
b'5643' | file("test/a.bin", False)
# returns ['5643']
cat("test/a.bin") | deref()

You can create temporary files on the fly:

# creates temporary file
url = range(3) > file()
# returns ['0', '1', '2']
cat(url) | deref()

This can be especially useful when integrating with shell scripts that wants to read in a file:

seq1 = "CCAAACCCCCCCTCCCCCGCTTC"
seq2 = "CCAAACCCCCCCCTCCCCCCGCTTC"
# use "needle" program to locally align 2 sequences
None | cmd(f"needle {[seq1] > file()} {[seq2] > file()} -filter")

You can also append to file with the “>>” operator:

url = range(3) > file()
# appended to file
range(10, 13) >> file(url)
# returns ['0', '1', '2', '10', '11', '12']
cat(url) | deref()
Parameters
  • fileName – if not specified, create new temporary file and returns the url when pipes into it

  • text – if True, accepts Iterator[str], and prints out each string on a new line. Else accepts bytes and write in 1 go.

__ror__(it: Iterator[str])None[source]
property name

File name of this file

class k1lib.cli.output.pretty(delim='')[source]

Bases: k1lib.cli.init.BaseCli

__init__(delim='')[source]

Pretty prints a table. Not really used directly. Example:

# These 2 statements are pretty much the same
[range(10), range(10)] | head(5) | pretty() > stdout()
[range(10), range(10)] | display()
__ror__(it: k1lib.cli.init.Table[Any])Iterator[str][source]
k1lib.cli.output.display(lines: int = 10)[source]

Convenience method for displaying a table

k1lib.cli.output.headOut(lines: int = 10)[source]

Convenience method for head() | stdout()

class k1lib.cli.output.intercept(raiseError: bool = True)[source]

Bases: k1lib.cli.init.BaseCli

__init__(raiseError: bool = True)[source]

Intercept flow at a particular point, analyze the object piped in, and raises error to stop flow. Example:

3 | intercept()
Parameters

raiseError – whether to raise error when executed or not.

__ror__(s)[source]

sam module

This is for functions that are .sam or .bam related

k1lib.cli.sam.cat(bamFile: Optional[str] = None, header: bool = True)[source]

Get sam file outputs from bam file. Example:

sam.cat("file.bam") | display()
"file.bam" | sam.cat(header=False) | display()
Parameters

header – whether to include headers or not

class k1lib.cli.sam.header(long=True)[source]

Bases: k1lib.cli.init.BaseCli

__init__(long=True)[source]

Adds a header to the table. Example:

sam.cat("file.bam") | sam.header() | display()

You can change the header labels like this:

settings.cli.sam.header.long = ["Query template name", ...]
Parameters

long – whether to use a long descriptive header, or a short one

__ror__(it)[source]
class k1lib.cli.sam.flag(f=None)[source]

Bases: k1lib.cli.utils.bindec

__init__(f=None)[source]

Decodes flags attribute. Example:

# returns ['PAIRED', 'UNMAP']
5 | flag()
# returns 'PAIRED, UNMAP'
5 | flag(cli.join(", "))

You’ll mostly use this in this format:

sam.cat("file.bam", False) | apply(sam.flag(), 1) | display()

You can change the flag labels like this:

settings.cli.sam.flags = ["paired", ...]
Parameters

f – transform function fed into bindec, defaulted to join(“, “)

structural module

This is for functions that sort of changes the table structure in a dramatic way. They’re the core transformations

k1lib.cli.structural.yieldSentinel

Object that can be yielded in a stream to ignore this stream for the moment in joinStreamsRandom. It will also stops deref early.

class k1lib.cli.structural.joinStreamsRandom(fs: list = [])[source]

Join multiple streams randomly. If any streams runs out, then quits. If any stream yields yieldSentinel, then just ignores that result and continue. Could be useful in active learning. Example:

# could return [0, 1, 10, 2, 11, 12, 13, ...], with max length 20, typical length 18
[range(0, 10), range(10, 20)] | joinStreamsRandom() | deref()

stream2 = [[-5, yieldSentinel, -4, -3], yieldSentinel | repeat()] | joinStreams()
# could return [-5, -4, 0, -3, 1, 2, 3, 4, 5, 6], demonstrating yieldSentinel
[range(7), stream2] | joinStreamsRandom() | deref()
__ror__(streams: Iterator[Iterator[T]])Iterator[T][source]
class k1lib.cli.structural.transpose(dim1: int = 0, dim2: int = 1, fill=None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(dim1: int = 0, dim2: int = 1, fill=None)[source]

Join multiple columns and loop through all rows. Aka transpose. Example:

# returns [[1, 4], [2, 5], [3, 6]]
[[1, 2, 3], [4, 5, 6]] | transpose() | deref()
# returns [[1, 4], [2, 5], [3, 6], [0, 7]]
[[1, 2, 3], [4, 5, 6, 7]] | transpose(fill=0) | deref()

Multidimensional transpose works just like torch.transpose() too:

# returns (2, 7, 5, 3), but detected Tensor, so it will use builtin :meth:`torch.transpose`
torch.randn(2, 3, 5, 7) | transpose(3, 1) | shape()
# also returns (2, 7, 5, 3), but actually does every required computation. Can be slow if shape is huge
torch.randn(2, 3, 5, 7) | deref(ignoreTensors=False) | transpose(3, 1) | shape()

Be careful with infinite streams, as transposing stream of shape (inf, 5) will hang this operation! Either don’t do it, or temporarily limit all infinite streams like this:

with settings.cli.context(inf=21):
    # returns (3, 21)
    [2, 1, 3] | repeat() | transpose() | shape()

Also be careful with empty streams, as you might not get any results at all:

# returns [], as the last stream has no elements
[[1, 2], [3, 4], []] | transpose() | deref()
# returns [[1, 3, 0], [2, 4, 0]]
[[1, 2], [3, 4], []] | transpose(fill=0) | deref()
Parameters

fill – if not None, then will try to zip longest with this fill value

__ror__(it: Iterator[Iterator[T]])k1lib.cli.init.Table[T][source]
static fill(fill='', dim1: int = 0, dim2: int = 1)[source]

Convenience method to fill in missing elements of a table. Example:

# returns [[1, 2, 3], [4, 5, 0]]
[[1, 2, 3], [4, 5]] | transpose.fill(0) | deref()
# also returns [[1, 2, 3], [4, 5, 0]], demonstrating how it works underneath
[[1, 2, 3], [4, 5]] | transpose(fill=0) | transpose(fill=0) | deref()
static wrap(f, dim1: int = 0, dim2: int = 1, fill=None)[source]

Wraps f around 2 transpose`s, can be useful in combination with :class:`k1lib.cli.init.mtmS. Example:

# returns [[1, 4, 3, 4], [8, 81, 10, 11]]
[range(1, 5), range(8, 12)] | transpose.wrap(mtmS.f(apply(op()**2), 1)) | deref()
# also returns [[1, 4, 3, 4], [8, 81, 10, 11]], demonstrating the typical way to do this
[range(1, 5), range(8, 12)] | apply(op()**2, 1) | deref()

The example given is sort of to demonstrate this only. Most of the time, just use apply with columns instead. But sometimes you need direct access to a column, so this is how you can do it.

class k1lib.cli.structural.reshape(*dims)[source]

Bases: k1lib.cli.init.BaseCli

__init__(*dims)[source]

Reshapes the input stream into the desired shape. Example:

# returns [[0, 1, 2], [3, 4, 5]]
range(6) | reshape(2, 3) | deref()
# returns [[0, 1], [2, 3], [4, 5]]
range(6) | reshape(3, 2) | deref()
# returns [[0, 1], [2, 3], [4, 5]], stopped early
range(100) | reshape(3, 2) | deref()
# returns [[0, 1, 2], [3, 4, 5]], can leave out first dimension
range(6) | reshape(-1, 3) | deref()
# returns [[0, 1, 2]], won't include 2nd element, as it ran out of elements
range(5) | reshape(-1, 3) | deref()
# throws error, as it ran out of elements and can't fulfill the request
range(6) | reshape(3, 3) | deref()

Unlike torch.reshape(), the input piped into this has to be a simple iterator. If you have a complex data structure with multiple dimensions, turn that into a simple iterator with joinStreams first, like this:

# returns [[[0, 1, 2]], [[3, 4, 5]]]
[[[0], [1]], [[2], [3]], [[4], [5]]] | joinStreams(2) | reshape(2, 1, 3) | deref()
__ror__(it)[source]
class k1lib.cli.structural.joinList(element=None, begin=True)[source]

Bases: k1lib.cli.init.BaseCli

__init__(element=None, begin=True)[source]

Join element into list. Example:

# returns [5, 2, 6, 8]
[5, [2, 6, 8]] | joinList() | deref()
# also returns [5, 2, 6, 8]
[2, 6, 8] | joinList(5) | deref()
Parameters

element – the element to insert. If None, then takes the input [e, […]], else takes the input […] as usual

__ror__(it: Tuple[T, Iterator[T]])Iterator[T][source]
class k1lib.cli.structural.splitW(*weights: List[float])[source]

Bases: k1lib.cli.init.BaseCli

__init__(*weights: List[float])[source]

Splits elements into multiple weighted lists. If no weights are provided, then automatically defaults to [0.8, 0.2]. Example:

# returns [[0, 1, 2, 3, 4, 5, 6, 7], [8, 9]]
range(10) | splitW(0.8, 0.2) | deref()
# same as the above
range(10) | splitW() | deref()
__ror__(it)[source]
class k1lib.cli.structural.joinStreams(dims=1)[source]

Bases: k1lib.cli.init.BaseCli

__init__(dims=1)[source]

Joins multiple streams. Example:

# returns [1, 2, 3, 4, 5]
[[1, 2, 3], [4, 5]] | joinStreams() | deref()
# returns [[0, 1], [2], [3, 4, 5], [6, 7, 8], [], [9, 10]]
[[[0, 1], [2], [3, 4, 5]], [[6, 7, 8], [], [9, 10]]] | joinStreams() | deref()
# returns [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10]
[[[0, 1], [2], [3, 4, 5]], [[6, 7, 8], [], [9, 10]]] | joinStreams(2) | deref()

Sometimes, you may want to impose some dimensional structure after joining all streams together, which reshape does.

__ror__(streams: Iterator[Iterator[T]])Iterator[T][source]
class k1lib.cli.structural.activeSamples(limit: int = 100, p: float = 0.95)[source]

Bases: k1lib.cli.init.BaseCli

__init__(limit: int = 100, p: float = 0.95)[source]

Yields active learning samples. Example:

o = activeSamples()
ds = range(10) # normal dataset
ds = [o, ds] | joinStreamsRandom() # dataset with active learning capability
next(ds) # returns 0
next(ds) # returns 1
next(ds) # returns 2
o.append(20)
next(ds) # can return     3     or 20
next(ds) # can return (4 or 20) or 4

So the point of this is to be a generator of samples. You can define your dataset as a mix of active learning samples and standard samples. Whenever there’s a data point that you want to focus on, you can add it to o and it will eventially yield it.

Warning

It might not be a good idea to set param limit to higher numbers than 100. This is because, the network might still not understand a wrong sample after being shown multiple times, and will keep adding that wrong sample back in, distracting it from other samples, and reduce network’s accuracy after removing active learning from it.

If limit is low enough (from my testing, 30-100 should be fine), then old wrong samples will be kicked out, allowing for a fresh stream of wrong samples coming in, and preventing the problem above. If you found that removing active learning makes the accuracy drops dramatically, then try decreasing the limit.

Parameters
  • limit – max number of active samples. Discards samples if number of samples is over this.

  • p – probability of actually adding the samples in

append(item)[source]

Adds 1 sample.

extend(items)[source]

Adds multiple samples.

k1lib.cli.structural.table(delim: Optional[str] = None)[source]

Basically op().split(delim).all(). This exists because this is used quite a lot in bioinformatics. Example:

# returns [['a', 'bd'], ['1', '2', '3']]
["a|bd", "1|2|3"] | table("|") | deref()
class k1lib.cli.structural.batched(bs=32, includeLast=False)[source]

Bases: k1lib.cli.init.BaseCli

__init__(bs=32, includeLast=False)[source]

Batches the input stream. Example:

# returns [[0, 1, 2], [3, 4, 5], [6, 7, 8]]
range(11) | batched(3) | deref()
# returns [[0, 1, 2], [3, 4, 5], [6, 7, 8], [9, 10]]
range(11) | batched(3, True) | deref()
# returns [[0, 1, 2, 3, 4]]
range(5) | batched(float("inf"), True) | deref()
# returns []
range(5) | batched(float("inf"), False) | deref()
__ror__(it)[source]
k1lib.cli.structural.collate()[source]

Puts individual columns into a tensor. Example:

# returns [tensor([ 0, 10, 20]), tensor([ 1, 11, 21]), tensor([ 2, 12, 22])]
[range(0, 3), range(10, 13), range(20, 23)] | collate() | toList()
k1lib.cli.structural.insertRow(*row: List[T])[source]

Inserts a row right before every other rows. See also: joinList().

k1lib.cli.structural.insertColumn(*column, begin=True, fill='')[source]

Inserts a column at beginning or end. Example:

# returns [['a', 1, 2], ['b', 3, 4]]
[[1, 2], [3, 4]] | insertColumn("a", "b") | deref()
k1lib.cli.structural.insertIdColumn(table=False, begin=True, fill='')[source]

Inserts an id column at the beginning (or end). Example:

# returns [[0, 'a', 2], [1, 'b', 4]]
[["a", 2], ["b", 4]] | insertIdColumn(True) | deref()
# returns [[0, 'a'], [1, 'b']]
"ab" | insertIdColumn()
Parameters

table – if False, then insert column to an Iterator[str], else treat input as a full fledged table

class k1lib.cli.structural.toDict[source]

Bases: k1lib.cli.init.BaseCli

__init__()[source]

Converts 2 Iterators, 1 key, 1 value into a dictionary. Example:

# returns {1: 3, 2: 4}
[[1, 2], [3, 4]] | toDict()
__ror__(it: Tuple[Iterator[T], Iterator[T]])dict[source]
class k1lib.cli.structural.toDictF(keyF: Optional[Callable[[Any], str]] = None, valueF: Optional[Callable[[Any], Any]] = None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(keyF: Optional[Callable[[Any], str]] = None, valueF: Optional[Callable[[Any], Any]] = None)[source]

Transform an incoming stream into a dict using a function for values. Example:

names = ["wanda", "vision", "loki", "mobius"]
names | toDictF(valueF=lambda s: len(s)) # will return {"wanda": 5, "vision": 6, ...}
names | toDictF(lambda s: s.title(), lambda s: len(s)) # will return {"Wanda": 5, "Vision": 6, ...}
__ror__(keys: Iterator[Any])Dict[Any, Any][source]
class k1lib.cli.structural.expandE(f: Callable[[T], List[T]], column: int)[source]

Bases: k1lib.cli.init.BaseCli

__init__(f: Callable[[T], List[T]], column: int)[source]

Expands table element to multiple columns. Example:

# returns [['abc', 3, -2], ['de', 2, -5]]
[["abc", -2], ["de", -5]] | expandE(lambda e: (e, len(e)), 0) | deref()
Parameters

f – Function that transforms 1 row element to multiple elements

__ror__(it)[source]
k1lib.cli.structural.unsqueeze(dim: int = 0)[source]

Unsqueeze input iterator. Example:

t = [[1, 2], [3, 4], [5, 6]]
# returns (3, 2)
t | shape()
# returns (1, 3, 2)
t | unsqueeze(0) | shape()
# returns (3, 1, 2)
t | unsqueeze(1) | shape()
# returns (3, 2, 1)
t | unsqueeze(2) | shape()

Behind the scenes, it’s really just wrapList().all(dim), but the “unsqueeze” name is a lot more familiar. Also note that the inverse operation “squeeze” is sort of item().all(dim), if you’re sure that this is desirable:

t = [[1, 2], [3, 4], [5, 6]]
# returns (3, 2)
t | unsqueeze(1) | item().all(1) | shape()
class k1lib.cli.structural.count(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Finds unique elements and returns a table with [frequency, value, percent] columns. Example:

# returns [[1, 'a', '33%'], [2, 'b', '67%']]
['a', 'b', 'b'] | count() | deref()
__ror__(it: Iterator[str])[source]
class k1lib.cli.structural.permute(*permutations: List[int])[source]

Bases: k1lib.cli.init.BaseCli

__init__(*permutations: List[int])[source]

Permutes the columns. Acts kinda like torch.Tensor.permute(). Example:

# returns [['b', 'a'], ['d', 'c']]
["ab", "cd"] | permute(1, 0) | deref()
__ror__(it: Iterator[str])[source]
class k1lib.cli.structural.accumulate(columnIdx: int = 0, avg=False)[source]

Bases: k1lib.cli.init.BaseCli

__init__(columnIdx: int = 0, avg=False)[source]

Groups lines that have the same row[columnIdx], and add together all other columns, assuming they’re numbers

Parameters
  • columnIdx – common column index to accumulate

  • avg – calculate average values instead of sum

__ror__(it: Iterator[str])[source]
class k1lib.cli.structural.AA_(*idxs: List[int], wraps=False)[source]

Bases: k1lib.cli.init.BaseCli

__init__(*idxs: List[int], wraps=False)[source]

Returns 2 streams, one that has the selected element, and the other the rest. Example:

# returns [5, [1, 6, 3, 7]]
[1, 5, 6, 3, 7] | AA_(1)
# returns [[5, [1, 6, 3, 7]]]
[1, 5, 6, 3, 7] | AA_(1, wraps=True)

You can also put multiple indexes through:

# returns [[1, [5, 6]], [6, [1, 5]]]
[1, 5, 6] | AA_(0, 2)

If you don’t specify anything, then all indexes will be sliced:

# returns [[1, [5, 6]], [5, [1, 6]], [6, [1, 5]]]
[1, 5, 6] | AA_()

As for why the strange name, think of this operation as “AĀ”. In statistics, say you have a set “A”, then “not A” is commonly written as A with an overline “Ā”. So “AA_” represents “AĀ”, and that it first returns the selection A.

Parameters

wraps – if True, then the first example will return [[5, [1, 6, 3, 7]]] instead, so that A has the same signature as Ā

__ror__(it: List[Any])List[List[List[Any]]][source]
class k1lib.cli.structural.peek(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Returns (firstRow, iterator). This sort of peaks at the first row, to potentially gain some insights about the internal formats. The returned iterator is not tampered. Example:

e, it = iter([[1, 2, 3], [1, 2]]) | peek()
print(e) # prints "[1, 2, 3]"
s = 0
for e in it: s += len(e)
print(s) # prints "5", or length of 2 lists

You kinda have to be careful about handling the firstRow, because you might inadvertently alter the iterator:

e, it = iter([iter(range(3)), range(4), range(2)]) | peek()
e = list(e) # e is [0, 1, 2]
list(next(it)) # supposed to be the same as `e`, but is [] instead

The example happens because you have already consumed all elements of the first row, and thus there aren’t any left when you try to call next(it).

__ror__(it: Iterator[T])Tuple[T, Iterator[T]][source]
class k1lib.cli.structural.peekF(f: Union[k1lib.cli.init.BaseCli, Callable[[T], T]])[source]

Bases: k1lib.cli.init.BaseCli

__init__(f: Union[k1lib.cli.init.BaseCli, Callable[[T], T]])[source]

Similar to peek, but will execute f(row) and return the input Iterator, which is not tampered. Example:

it = lambda: iter([[1, 2, 3], [1, 2]])
# prints "[1, 2, 3]" and returns [[1, 2, 3], [1, 2]]
it() | peekF(lambda x: print(x)) | deref()
# prints "1\n2\n3"
it() | peekF(headOut()) | deref()
__ror__(it: Iterator[T])Iterator[T][source]
class k1lib.cli.structural.repeat(limit: Optional[int] = None)[source]

Bases: k1lib.cli.init.BaseCli

Yields a specified amount of the passed in object. If you intend to pass in an iterator, then make a list out of it first, as second copy of iterator probably won’t work as you will have used it the first time. Example:

# returns [[1, 2, 3], [1, 2, 3], [1, 2, 3]]
[1, 2, 3] | repeat(3) | toList()
Parameters

repeat – if None, then repeats indefinitely

__ror__(o: T)Iterator[T][source]
k1lib.cli.structural.repeatF(f, limit: Optional[int] = None)[source]

Yields a specified amount generated by a specified function. Example:

# returns [4, 4, 4]
repeatF(lambda: 4, 3) | toList()
# returns 10
repeatF(lambda: 4) | head() | shape(0)
Parameters

limit – if None, then repeats indefinitely

See also: repeatFrom

class k1lib.cli.structural.repeatFrom(limit: Optional[int] = None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(limit: Optional[int] = None)[source]

Yields from a list. If runs out of elements, then do it again for limit times. Example:

# returns [1, 2, 3, 1, 2]
[1, 2, 3] | repeatFrom() | head(5) | deref()
# returns [1, 2, 3, 1, 2, 3]
[1, 2, 3] | repeatFrom(2) | deref()
Parameters

limit – if None, then repeats indefinitely

__ror__(it: Iterator[T])Iterator[T][source]

trace module

class k1lib.cli.trace.trace(f=<k1lib.cli.utils.size object>, maxDepth=inf)[source]

Bases: k1lib.cli.trace._trace

last = None

Last instantiated trace object. Access this to view the previous (possibly nested) trace.

__init__(f=<k1lib.cli.utils.size object>, maxDepth=inf)[source]

Traces out how the data stream is transformed through complex cli tools. Example:

# returns [1, 4, 9, 16], normal command
range(1, 5) | apply(lambda x: x**2) | deref()
# traced command, will display how the shapes evolve through cli tools
range(1, 5) | trace() | apply(lambda x: x**2) | deref()

There’re a lot more instructions and code examples over the tutorial section. Go check it out!

Parameters

f – function to display the data stream. Defaulted to shape, and to iden if is None.

utils module

This is for all short utilities that has the boilerplate feeling. Conversion clis might feel they have different styles, as toFloat converts object iterator to float iterator, while toPIL converts single image url to single PIL image, whereas toSum converts float iterator into a single float value.

The general convention is, if the intended operation sounds simple (convert to floats, strings, types, …), then most likely it will convert iterator to iterator, as you can always use the function directly if you only want to apply it on 1 object.

If it sounds complicated (convert to PIL image, tensor, …) then most likely it will convert object to object. Lastly, there are some that just feels right to input an iterator and output a single object (like getting max, min, std, mean values).

class k1lib.cli.utils.size(idx=None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(idx=None)[source]

Returns number of rows and columns in the input. Example:

# returns (3, 2)
[[2, 3], [4, 5, 6], [3]] | size()
# returns 3
[[2, 3], [4, 5, 6], [3]] | size(0)
# returns 2
[[2, 3], [4, 5, 6], [3]] | size(1)
# returns (2, 0)
[[], [2, 3]] | size()
# returns (3,)
[2, 3, 5] | size()
# returns 3
[2, 3, 5] | size(0)
# returns (3, 2, 2)
[[[2, 1], [0, 6, 7]], 3, 5] | size()
# returns (1,) and not (1, 3)
["abc"] | size()
# returns (1, 2, 3)
[torch.randn(2, 3)] | size()
# returns (2, 3, 5)
size()(np.random.randn(2, 3, 5))

There’s also lengths, which is sort of a simplified/faster version of this, but only use it if you are sure that len(it) can be called.

If encounter PyTorch tensors or Numpy arrays, then this will just get the shape instead of actually looping over them.

Parameters

idx – if idx is None return (rows, columns). If 0 or 1, then rows or columns

__ror__(it: Iterator[str])[source]
k1lib.cli.utils.shape

alias of k1lib.cli.utils.size

class k1lib.cli.utils.item(amt: int = 1, fill=<object object>)[source]

Bases: k1lib.cli.init.BaseCli

__init__(amt: int = 1, fill=<object object>)[source]

Returns the first row. Example:

# returns 0
iter(range(5)) | item()
# returns torch.Size([5])
torch.randn(3,4,5) | item(2) | shape()
# returns 3
[] | item(fill=3)
Parameters
  • amt – how many times do you want to call item() back to back?

  • fill – if iterator length is 0, return this

__ror__(it: Iterator[str])[source]
class k1lib.cli.utils.identity(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Yields whatever the input is. Useful for multiple streams. Example:

# returns range(5)
range(5) | identity()
__ror__(it: Iterator[Any])[source]
k1lib.cli.utils.iden

alias of k1lib.cli.utils.identity

class k1lib.cli.utils.toStr(column: Optional[int] = None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(column: Optional[int] = None)[source]

Converts every line to a string. Example:

# returns ['2', 'a']
[2, "a"] | toStr() | deref()
# returns [[2, 'a'], [3, '5']]
assert [[2, "a"], [3, 5]] | toStr(1) | deref()
__ror__(it: Iterator[str])[source]
class k1lib.cli.utils.join(delim: Optional[str] = None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(delim: Optional[str] = None)[source]

Merges all strings into 1, with delim in the middle. Basically str.join(). Example:

# returns '2\na'
[2, "a"] | join("\n")
__ror__(it: Iterator[str])[source]
class k1lib.cli.utils.toNumpy(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Converts generator to numpy array. Essentially np.array(list(it))

__ror__(it: Iterator[float])numpy.array[source]
class k1lib.cli.utils.toTensor(dtype=torch.float32)[source]

Bases: k1lib.cli.init.BaseCli

__init__(dtype=torch.float32)[source]

Converts generator to torch.Tensor. Essentially torch.tensor(list(it)).

Also checks if input is a PIL Image. If yes, turn it into a torch.Tensor and return.

__ror__(it: Iterator[float])torch.Tensor[source]
class k1lib.cli.utils.toList(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Converts generator to list. list would do the same, but this is just to maintain the style

__ror__(it: Iterator[Any])List[Any][source]
class k1lib.cli.utils.wrapList(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Wraps inputs inside a list. There’s a more advanced cli tool built from this, which is unsqueeze().

__ror__(it: T)List[T][source]
class k1lib.cli.utils.toSet(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Converts generator to set. set would do the same, but this is just to maintain the style

__ror__(it: Iterator[T])Set[T][source]
class k1lib.cli.utils.toIter(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Converts object to iterator. iter() would do the same, but this is just to maintain the style

__ror__(it: List[T])Iterator[T][source]
class k1lib.cli.utils.toRange(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Returns iter(range(len(it))), effectively

__ror__(it: Iterator[Any])Iterator[int][source]
class k1lib.cli.utils.toType(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Converts object to its type. Example:

# returns [int, float, str, torch.Tensor]
[2, 3.5, "ah", torch.randn(2, 3)] | toType() | deref()
__ror__(it: Iterator[T])Iterator[type][source]
class k1lib.cli.utils.equals[source]

Bases: object

Checks if all incoming columns/streams are identical

__ror__(streams: Iterator[Iterator[str]])[source]
class k1lib.cli.utils.reverse(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Reverses incoming list. Example:

# returns [3, 5, 2]
[2, 5, 3] | reverse() | deref()
__ror__(it: Iterator[str])List[str][source]
class k1lib.cli.utils.ignore(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Just loops through everything, ignoring the output. Example:

# will just return an iterator, and not print anything
[2, 3] | apply(lambda x: print(x))
# will prints "2\n3"
[2, 3] | apply(lambda x: print(x)) | ignore()
__ror__(it: Iterator[Any])[source]
class k1lib.cli.utils.rateLimit(f, delay=0.1)[source]

Bases: k1lib.cli.init.BaseCli

__init__(f, delay=0.1)[source]

Limits the execution flow rate upon a condition. Example:

s = 0; semaphore = 0
def heavyAsyncOperation(i):
    global semaphore, s
    semaphore += 1
    s += i; time.sleep(1)
    semaphore -= 1; return i**2

# returns (20,), takes 1s to run
range(20) | applyTh(heavyAsyncOperation, 100) | shape()
# returns (20,), takes 4s to run (20/5 = 4)
range(20) | rateLimit(lambda: semaphore < 5) | applyTh(heavyAsyncOperation, 100) | shape()

The first test case is not rate-limited, so it will run all 20 threads at the same time, and all of them will finish after 1 second.

The second test case is rate-limited, so that there can only be 5 concurrently executing threads because of the semaphore count check. Therefore this takes around 4 seconds to run.

Parameters
  • f – checking function. Should return true if execution is allowed

  • delay – delay in seconds between calling f()

__ror__(it)[source]
static cpu(maxUtilization=90)[source]

Limits flow rate when cpu utilization is more than a specified percentage amount. Needs to install the package psutil to actually work. Example:

# returns [0, 1, 4, 9, 16]
range(5) | rateLimit.cpu() | apply(op()**2) | deref()
class k1lib.cli.utils.toSum(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Calculates the sum of list of numbers. Can pipe in torch.Tensor. Example:

# returns 45
range(10) | toSum()
__ror__(it: Iterator[float])[source]
class k1lib.cli.utils.toAvg(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Calculates average of list of numbers. Can pipe in torch.Tensor. Example:

# returns 4.5
range(10) | toAvg()
# returns nan
[] | toAvg()
__ror__(it: Iterator[float])[source]
k1lib.cli.utils.toMean

alias of k1lib.cli.utils.toAvg

class k1lib.cli.utils.toMax(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Calculates the max of a bunch of numbers. Can pipe in torch.Tensor. Example:

# returns 6
[2, 5, 6, 1, 2] | toMax()
__ror__(it: Iterator[float])float[source]
class k1lib.cli.utils.toMin(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Calculates the min of a bunch of numbers. Can pipe in torch.Tensor. Example:

# returns 1
[2, 5, 6, 1, 2] | toMin()
__ror__(it: Iterator[float])float[source]
class k1lib.cli.utils.toPIL[source]

Bases: k1lib.cli.init.BaseCli

__init__()[source]

Converts a path to a PIL image. Example:

ls(".") | toPIL().all() | item() # get first image
__ror__(path)PIL.Image.Image[source]
class k1lib.cli.utils.toBin(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Converts integer to binary string. Example:

# returns "101"
5 | toBin()
__ror__(it)[source]
class k1lib.cli.utils.toIdx(chars: str)[source]

Bases: k1lib.cli.init.BaseCli

__init__(chars: str)[source]

Get index of characters according to a reference. Example:

# returns [1, 4, 4, 8]
"#&&*" | toIdx("!#$%&'()*+") | deref()
__ror__(it)[source]
class k1lib.cli.utils.lengths(fs: list = [])[source]

Bases: k1lib.cli.init.BaseCli

Returns the lengths of each element. Example:

[range(5), range(10)] | lengths() == [5, 10]

This is a simpler (and faster!) version of shape. It assumes each element can be called with len(x), while shape iterates through every elements to get the length, and thus is much slower.

__ror__(it: Iterator[List[Any]])Iterator[int][source]
k1lib.cli.utils.headerIdx()[source]

Cuts out first line, put an index column next to it, and prints it out. Useful when you want to know what your column’s index is to cut it out. Also sets the context variable “header”, in case you need it later. Example:

# returns [[0, 'a'], [1, 'b'], [2, 'c']]
["abc"] | headerIdx() | deref()
class k1lib.cli.utils.deref(maxDepth=inf, ignoreTensors=True)[source]

Bases: k1lib.cli.init.BaseCli

__init__(maxDepth=inf, ignoreTensors=True)[source]

Recursively converts any iterator into a list. Only str, numbers.Number and Module are not converted. Example:

# returns something like "<range_iterator at 0x7fa8c52ca870>"
iter(range(5))
# returns [0, 1, 2, 3, 4]
iter(range(5)) | deref()
# returns [2, 3], yieldSentinel stops things early
[2, 3, yieldSentinel, 6] | deref()

You can also specify a maxDepth:

# returns something like "<list_iterator at 0x7f810cf0fdc0>"
iter([range(3)]) | deref(0)
# returns [range(3)]
iter([range(3)]) | deref(1)
# returns [[0, 1, 2]]
iter([range(3)]) | deref(2)

There are a few classes/types that are considered atomic, and deref will never try to iterate over it. If you wish to change it, do something like:

settings.cli.atomic.deref = (int, float, ...)

Warning

Can work well with PyTorch Tensors, but not Numpy arrays as they screw things up with the __ror__ operator, so do torch.from_numpy(…) first. Don’t worry about unnecessary copying, as numpy and torch both utilizes the buffer protocol.

Parameters
  • maxDepth – maximum depth to dereference. Starts at 0 for not doing anything at all

  • ignoreTensors – if True, then don’t loop over torch.Tensor internals

__ror__(it: Iterator[T])List[T][source]
__invert__()k1lib.cli.init.BaseCli[source]

Returns a BaseCli that makes everything an iterator. Not entirely sure when this comes in handy, but it’s there.

class k1lib.cli.utils.bindec(cats: List[Any], f=None)[source]

Bases: k1lib.cli.init.BaseCli

__init__(cats: List[Any], f=None)[source]

Binary decodes the input. Example:

# returns ['a', 'c']
5 | bindec("abcdef")
# returns 'a,c'
5 | bindec("abcdef", join(","))
Parameters
  • cats – categories

  • f – transformation function of the selected elements. Defaulted to toList, but others like join is useful too

__ror__(it)[source]
k1lib.cli.utils.smooth(consecutives=None)[source]

Smoothes out the input stream. Literally just a shortcut for:

batched(consecutives) | toMean().all()

Example:

# returns [4.5, 14.5, 24.5]
range(30) | smooth(10) | deref()
Parameters

consecutives – if not defined, then used the value inside settings.cli.smooth

others module

This is for pretty random clis that’s scattered everywhere.

k1lib.cli.others.crissCross()[source]

Like the monkey-patched function torch.crissCross(). Example:

# returns another Tensor
[torch.randn(3, 3), torch.randn(3)] | crissCross()

Elsewhere in the library

There might still be more cli tools scattered around the library. These are pretty rare, quite dynamic and most likely a cool extra feature, not a core functionality, so not worth it/can’t mention it here. Anyway, execute this:

cli.scatteredClis()

to get a list of them.